ID: 913332430

View in Genome Browser
Species Human (GRCh38)
Location 1:117678617-117678639
Sequence CTCAAGAAGAAGTGGTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913332430_913332442 17 Left 913332430 1:117678617-117678639 CCCTGGCACCACTTCTTCTTGAG No data
Right 913332442 1:117678657-117678679 GGCCTTGTAACCCCAGCCTGGGG No data
913332430_913332440 15 Left 913332430 1:117678617-117678639 CCCTGGCACCACTTCTTCTTGAG No data
Right 913332440 1:117678655-117678677 CAGGCCTTGTAACCCCAGCCTGG No data
913332430_913332434 -4 Left 913332430 1:117678617-117678639 CCCTGGCACCACTTCTTCTTGAG No data
Right 913332434 1:117678636-117678658 TGAGACGGCTCCCCTATCCCAGG No data
913332430_913332441 16 Left 913332430 1:117678617-117678639 CCCTGGCACCACTTCTTCTTGAG No data
Right 913332441 1:117678656-117678678 AGGCCTTGTAACCCCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913332430 Original CRISPR CTCAAGAAGAAGTGGTGCCA GGG (reversed) Intergenic
No off target data available for this crispr