ID: 913333139

View in Genome Browser
Species Human (GRCh38)
Location 1:117683808-117683830
Sequence GGCAGGGATGTTCCCACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913333139_913333149 25 Left 913333139 1:117683808-117683830 CCCTGTGTGGGAACATCCCTGCC No data
Right 913333149 1:117683856-117683878 GCACAGTGCTGGCACATGCGAGG No data
913333139_913333146 14 Left 913333139 1:117683808-117683830 CCCTGTGTGGGAACATCCCTGCC No data
Right 913333146 1:117683845-117683867 GCCACTCCACAGCACAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913333139 Original CRISPR GGCAGGGATGTTCCCACACA GGG (reversed) Intergenic
No off target data available for this crispr