ID: 913333140

View in Genome Browser
Species Human (GRCh38)
Location 1:117683809-117683831
Sequence AGGCAGGGATGTTCCCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913333140_913333149 24 Left 913333140 1:117683809-117683831 CCTGTGTGGGAACATCCCTGCCT No data
Right 913333149 1:117683856-117683878 GCACAGTGCTGGCACATGCGAGG No data
913333140_913333146 13 Left 913333140 1:117683809-117683831 CCTGTGTGGGAACATCCCTGCCT No data
Right 913333146 1:117683845-117683867 GCCACTCCACAGCACAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913333140 Original CRISPR AGGCAGGGATGTTCCCACAC AGG (reversed) Intergenic
No off target data available for this crispr