ID: 913333141

View in Genome Browser
Species Human (GRCh38)
Location 1:117683824-117683846
Sequence GCACAGGCAGGCATGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913333141_913333150 23 Left 913333141 1:117683824-117683846 CCCTGCCTCATGCCTGCCTGTGC No data
Right 913333150 1:117683870-117683892 CATGCGAGGTGCTCAGCCCATGG No data
913333141_913333149 9 Left 913333141 1:117683824-117683846 CCCTGCCTCATGCCTGCCTGTGC No data
Right 913333149 1:117683856-117683878 GCACAGTGCTGGCACATGCGAGG No data
913333141_913333146 -2 Left 913333141 1:117683824-117683846 CCCTGCCTCATGCCTGCCTGTGC No data
Right 913333146 1:117683845-117683867 GCCACTCCACAGCACAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913333141 Original CRISPR GCACAGGCAGGCATGAGGCA GGG (reversed) Intergenic
No off target data available for this crispr