ID: 913333143

View in Genome Browser
Species Human (GRCh38)
Location 1:117683829-117683851
Sequence GAGTGGCACAGGCAGGCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913333143_913333146 -7 Left 913333143 1:117683829-117683851 CCTCATGCCTGCCTGTGCCACTC No data
Right 913333146 1:117683845-117683867 GCCACTCCACAGCACAGTGCTGG No data
913333143_913333149 4 Left 913333143 1:117683829-117683851 CCTCATGCCTGCCTGTGCCACTC No data
Right 913333149 1:117683856-117683878 GCACAGTGCTGGCACATGCGAGG No data
913333143_913333150 18 Left 913333143 1:117683829-117683851 CCTCATGCCTGCCTGTGCCACTC No data
Right 913333150 1:117683870-117683892 CATGCGAGGTGCTCAGCCCATGG No data
913333143_913333151 29 Left 913333143 1:117683829-117683851 CCTCATGCCTGCCTGTGCCACTC No data
Right 913333151 1:117683881-117683903 CTCAGCCCATGGTTACTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913333143 Original CRISPR GAGTGGCACAGGCAGGCATG AGG (reversed) Intergenic
No off target data available for this crispr