ID: 913333146

View in Genome Browser
Species Human (GRCh38)
Location 1:117683845-117683867
Sequence GCCACTCCACAGCACAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913333141_913333146 -2 Left 913333141 1:117683824-117683846 CCCTGCCTCATGCCTGCCTGTGC No data
Right 913333146 1:117683845-117683867 GCCACTCCACAGCACAGTGCTGG No data
913333142_913333146 -3 Left 913333142 1:117683825-117683847 CCTGCCTCATGCCTGCCTGTGCC No data
Right 913333146 1:117683845-117683867 GCCACTCCACAGCACAGTGCTGG No data
913333140_913333146 13 Left 913333140 1:117683809-117683831 CCTGTGTGGGAACATCCCTGCCT No data
Right 913333146 1:117683845-117683867 GCCACTCCACAGCACAGTGCTGG No data
913333139_913333146 14 Left 913333139 1:117683808-117683830 CCCTGTGTGGGAACATCCCTGCC No data
Right 913333146 1:117683845-117683867 GCCACTCCACAGCACAGTGCTGG No data
913333143_913333146 -7 Left 913333143 1:117683829-117683851 CCTCATGCCTGCCTGTGCCACTC No data
Right 913333146 1:117683845-117683867 GCCACTCCACAGCACAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913333146 Original CRISPR GCCACTCCACAGCACAGTGC TGG Intergenic
No off target data available for this crispr