ID: 913333149

View in Genome Browser
Species Human (GRCh38)
Location 1:117683856-117683878
Sequence GCACAGTGCTGGCACATGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913333143_913333149 4 Left 913333143 1:117683829-117683851 CCTCATGCCTGCCTGTGCCACTC No data
Right 913333149 1:117683856-117683878 GCACAGTGCTGGCACATGCGAGG No data
913333142_913333149 8 Left 913333142 1:117683825-117683847 CCTGCCTCATGCCTGCCTGTGCC No data
Right 913333149 1:117683856-117683878 GCACAGTGCTGGCACATGCGAGG No data
913333139_913333149 25 Left 913333139 1:117683808-117683830 CCCTGTGTGGGAACATCCCTGCC No data
Right 913333149 1:117683856-117683878 GCACAGTGCTGGCACATGCGAGG No data
913333140_913333149 24 Left 913333140 1:117683809-117683831 CCTGTGTGGGAACATCCCTGCCT No data
Right 913333149 1:117683856-117683878 GCACAGTGCTGGCACATGCGAGG No data
913333145_913333149 -7 Left 913333145 1:117683840-117683862 CCTGTGCCACTCCACAGCACAGT No data
Right 913333149 1:117683856-117683878 GCACAGTGCTGGCACATGCGAGG No data
913333144_913333149 -3 Left 913333144 1:117683836-117683858 CCTGCCTGTGCCACTCCACAGCA No data
Right 913333149 1:117683856-117683878 GCACAGTGCTGGCACATGCGAGG No data
913333141_913333149 9 Left 913333141 1:117683824-117683846 CCCTGCCTCATGCCTGCCTGTGC No data
Right 913333149 1:117683856-117683878 GCACAGTGCTGGCACATGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913333149 Original CRISPR GCACAGTGCTGGCACATGCG AGG Intergenic
No off target data available for this crispr