ID: 913333540

View in Genome Browser
Species Human (GRCh38)
Location 1:117686838-117686860
Sequence ATTCCTTGTTTTGCTTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913333540_913333542 23 Left 913333540 1:117686838-117686860 CCTCAATAAGCAAAACAAGGAAT No data
Right 913333542 1:117686884-117686906 TGTAGAACAACCAAGCCTCAAGG No data
913333540_913333543 29 Left 913333540 1:117686838-117686860 CCTCAATAAGCAAAACAAGGAAT No data
Right 913333543 1:117686890-117686912 ACAACCAAGCCTCAAGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913333540 Original CRISPR ATTCCTTGTTTTGCTTATTG AGG (reversed) Intergenic
No off target data available for this crispr