ID: 913335925

View in Genome Browser
Species Human (GRCh38)
Location 1:117708940-117708962
Sequence TGCCTCACGGGGTTGTTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913335917_913335925 -3 Left 913335917 1:117708920-117708942 CCTGCCGTTATTGGCCCTCCTGC No data
Right 913335925 1:117708940-117708962 TGCCTCACGGGGTTGTTGCGAGG No data
913335912_913335925 22 Left 913335912 1:117708895-117708917 CCAGGTCCATTTTATCACACTCC No data
Right 913335925 1:117708940-117708962 TGCCTCACGGGGTTGTTGCGAGG No data
913335916_913335925 -2 Left 913335916 1:117708919-117708941 CCCTGCCGTTATTGGCCCTCCTG No data
Right 913335925 1:117708940-117708962 TGCCTCACGGGGTTGTTGCGAGG No data
913335913_913335925 16 Left 913335913 1:117708901-117708923 CCATTTTATCACACTCCTCCCTG No data
Right 913335925 1:117708940-117708962 TGCCTCACGGGGTTGTTGCGAGG No data
913335915_913335925 1 Left 913335915 1:117708916-117708938 CCTCCCTGCCGTTATTGGCCCTC No data
Right 913335925 1:117708940-117708962 TGCCTCACGGGGTTGTTGCGAGG No data
913335918_913335925 -7 Left 913335918 1:117708924-117708946 CCGTTATTGGCCCTCCTGCCTCA No data
Right 913335925 1:117708940-117708962 TGCCTCACGGGGTTGTTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913335925 Original CRISPR TGCCTCACGGGGTTGTTGCG AGG Intergenic