ID: 913339747

View in Genome Browser
Species Human (GRCh38)
Location 1:117747069-117747091
Sequence TTCTGTTCCTAGGAGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913339743_913339747 -8 Left 913339743 1:117747054-117747076 CCCAGGTCAATGGAGTTCTGTTC No data
Right 913339747 1:117747069-117747091 TTCTGTTCCTAGGAGGATTATGG No data
913339744_913339747 -9 Left 913339744 1:117747055-117747077 CCAGGTCAATGGAGTTCTGTTCC No data
Right 913339747 1:117747069-117747091 TTCTGTTCCTAGGAGGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913339747 Original CRISPR TTCTGTTCCTAGGAGGATTA TGG Intergenic
No off target data available for this crispr