ID: 913343245

View in Genome Browser
Species Human (GRCh38)
Location 1:117781224-117781246
Sequence CTTCCCCAGAGAGCGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913343245_913343260 25 Left 913343245 1:117781224-117781246 CCTGACCCCGCTCTCTGGGGAAG No data
Right 913343260 1:117781272-117781294 CACTCACTGGAGCTGTTTCTGGG No data
913343245_913343259 24 Left 913343245 1:117781224-117781246 CCTGACCCCGCTCTCTGGGGAAG No data
Right 913343259 1:117781271-117781293 CCACTCACTGGAGCTGTTTCTGG No data
913343245_913343253 12 Left 913343245 1:117781224-117781246 CCTGACCCCGCTCTCTGGGGAAG No data
Right 913343253 1:117781259-117781281 CCTCCCCCAACTCCACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913343245 Original CRISPR CTTCCCCAGAGAGCGGGGTC AGG (reversed) Intergenic
No off target data available for this crispr