ID: 913346796

View in Genome Browser
Species Human (GRCh38)
Location 1:117817800-117817822
Sequence TGACACAACAAGTGACAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913346796_913346800 3 Left 913346796 1:117817800-117817822 CCCTACTGTCACTTGTTGTGTCA No data
Right 913346800 1:117817826-117817848 TGGGCAGTTGTCTTTGTCTCAGG No data
913346796_913346802 24 Left 913346796 1:117817800-117817822 CCCTACTGTCACTTGTTGTGTCA No data
Right 913346802 1:117817847-117817869 GGTATGCTTGAGCACATGCTGGG No data
913346796_913346801 23 Left 913346796 1:117817800-117817822 CCCTACTGTCACTTGTTGTGTCA No data
Right 913346801 1:117817846-117817868 AGGTATGCTTGAGCACATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913346796 Original CRISPR TGACACAACAAGTGACAGTA GGG (reversed) Intergenic
No off target data available for this crispr