ID: 913347831

View in Genome Browser
Species Human (GRCh38)
Location 1:117825796-117825818
Sequence CTGGTCAGTGAGGCTTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913347831_913347836 18 Left 913347831 1:117825796-117825818 CCAGCAAAAGCCTCACTGACCAG No data
Right 913347836 1:117825837-117825859 CTTTTTATCCTGCTCAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913347831 Original CRISPR CTGGTCAGTGAGGCTTTTGC TGG (reversed) Intergenic
No off target data available for this crispr