ID: 913347836

View in Genome Browser
Species Human (GRCh38)
Location 1:117825837-117825859
Sequence CTTTTTATCCTGCTCAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913347832_913347836 8 Left 913347832 1:117825806-117825828 CCTCACTGACCAGATGTCTGACT No data
Right 913347836 1:117825837-117825859 CTTTTTATCCTGCTCAGATCTGG No data
913347833_913347836 -1 Left 913347833 1:117825815-117825837 CCAGATGTCTGACTCCAAACTCC No data
Right 913347836 1:117825837-117825859 CTTTTTATCCTGCTCAGATCTGG No data
913347831_913347836 18 Left 913347831 1:117825796-117825818 CCAGCAAAAGCCTCACTGACCAG No data
Right 913347836 1:117825837-117825859 CTTTTTATCCTGCTCAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913347836 Original CRISPR CTTTTTATCCTGCTCAGATC TGG Intergenic
No off target data available for this crispr