ID: 913348957

View in Genome Browser
Species Human (GRCh38)
Location 1:117836777-117836799
Sequence AGAGAGAACTGAGTGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913348951_913348957 10 Left 913348951 1:117836744-117836766 CCATAAGAAATTTGTAACAGTGG No data
Right 913348957 1:117836777-117836799 AGAGAGAACTGAGTGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913348957 Original CRISPR AGAGAGAACTGAGTGGCTGG AGG Intergenic
No off target data available for this crispr