ID: 913351319

View in Genome Browser
Species Human (GRCh38)
Location 1:117863351-117863373
Sequence CTGACATGGAATAATACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913351319 Original CRISPR CTGACATGGAATAATACTGA TGG Intergenic
903049505 1:20590104-20590126 CAGACAGGGAATAATACCAAGGG - Intronic
903585172 1:24409396-24409418 CTAAAATGGTATAACACTGAGGG - Intronic
906718475 1:47988078-47988100 CTGACAAGGTATAACACTGTGGG + Intronic
907871392 1:58446744-58446766 CTGACATGGAACAACAAGGATGG - Intronic
909137287 1:71817334-71817356 CTGACATGGGCTAATTCTGGTGG + Intronic
909692001 1:78419881-78419903 CTGAAATGTGATAATACTGCTGG + Intronic
911808635 1:102244262-102244284 TTGACTTGGAACAATCCTGAAGG + Intergenic
911832218 1:102565511-102565533 CTGATATGAAATGATAATGAGGG + Intergenic
913222463 1:116670052-116670074 CTGAAATGGCATAAAACAGAAGG + Intergenic
913351319 1:117863351-117863373 CTGACATGGAATAATACTGATGG + Intergenic
915794244 1:158709931-158709953 CTCATATGAAATAATACTCAAGG - Intergenic
915999111 1:160597488-160597510 CTCACATGGCAGAATACAGAAGG - Intergenic
916094386 1:161336028-161336050 CTGGCTTGGAAAAAAACTGAAGG - Intronic
916877638 1:168986931-168986953 CTGCCCTGGAATAACACTCATGG + Intergenic
917956487 1:180104463-180104485 ATTACATGCAAAAATACTGAAGG - Intronic
921696364 1:218215159-218215181 CGGAAATGGAATAATACTGTAGG - Intergenic
922915381 1:229253044-229253066 CTGAGATGGGAGCATACTGATGG - Intergenic
923298273 1:232616105-232616127 CAGACATGGGCTAAGACTGAGGG - Intergenic
924266298 1:242285623-242285645 CTGCCATTGCATAATACAGATGG - Intronic
924598613 1:245468289-245468311 CTGACATGGAACCAGACAGAGGG + Intronic
1062765919 10:64785-64807 CTTACACTGACTAATACTGAAGG + Intergenic
1064721017 10:18228524-18228546 CAGACATGAAAGAATAGTGAAGG + Intronic
1066718531 10:38312937-38312959 CTGCCATTGCATAATACAGATGG + Intergenic
1068473568 10:57496076-57496098 CAAAGATGGAATAAAACTGAAGG + Intergenic
1072363224 10:94681242-94681264 ATGACATGGAATGAACCTGAAGG + Intergenic
1077921837 11:6647214-6647236 ATGACAGGGAACAAGACTGAGGG + Intronic
1078431801 11:11293825-11293847 CTGACATGAAATATTTATGAAGG - Intronic
1080198675 11:29642675-29642697 CTGACATGGAAAAATTGTTAGGG + Intergenic
1081451459 11:43174481-43174503 TTGACATGTAATAATATTTATGG - Intergenic
1082279787 11:50259679-50259701 CTCACATGGCAGAAAACTGAGGG - Intergenic
1085416658 11:76322858-76322880 GTGACAGTGAATAATAATGATGG - Intergenic
1085921430 11:80962537-80962559 CTGTTATGGAATAATACGCATGG - Intergenic
1087246004 11:95837958-95837980 CTTACATGCTATAATATTGAGGG - Intronic
1088032534 11:105268607-105268629 CTGTCATGGAATAATATCAAAGG + Intergenic
1088766641 11:112987753-112987775 CAAACATAGAATAAAACTGAAGG - Intronic
1089782271 11:120882074-120882096 ATGGCATGGAAGAATAGTGAGGG + Intronic
1090982321 11:131734286-131734308 CTGCCATGGTCTCATACTGAAGG + Intronic
1093354624 12:18151561-18151583 CAGATATGGAATTAGACTGAGGG + Intronic
1095588525 12:43875937-43875959 TTCATATGGAATAATTCTGATGG + Intronic
1096280284 12:50246713-50246735 CTGCCATGGAAAAATACAGAAGG - Intronic
1099169194 12:79343449-79343471 CTAAAATGGAAGAATAGTGATGG - Intronic
1107266801 13:38565321-38565343 TTGAAATGGAATAATACTATAGG + Intergenic
1108905963 13:55473634-55473656 CACACATGGAATAAAAGTGAGGG + Intergenic
1109415263 13:62031256-62031278 CTGACATGCATTCATACAGAAGG - Intergenic
1111116294 13:83782074-83782096 CTGCCATACAATAATAGTGAAGG + Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1115224880 14:31092249-31092271 CTGACAGAGAAGAAAACTGAAGG + Intronic
1115328410 14:32167615-32167637 CCAACTTGGGATAATACTGAAGG + Intergenic
1115704319 14:35982798-35982820 CATACATTGAATAATACTCATGG + Intergenic
1116630602 14:47326580-47326602 TTGAGAAGGAATAAAACTGAAGG - Intronic
1117308575 14:54499805-54499827 TCGACATGGCTTAATACTGATGG - Intergenic
1117746448 14:58874496-58874518 TTGACATGAAAAAATCCTGATGG + Intergenic
1119907416 14:78318402-78318424 CTGACATGGATTGCTATTGATGG + Intronic
1120115995 14:80618197-80618219 ATGATATGGAATAAAATTGATGG - Intronic
1121136218 14:91501272-91501294 CTGATTTGGATAAATACTGAAGG + Intronic
1121291765 14:92781623-92781645 CAGATTTGGAGTAATACTGATGG - Intergenic
1126747163 15:51837736-51837758 TTGACAAGGAATAATAATGGGGG - Intronic
1130861113 15:87890743-87890765 CTGACATAAAATAATACTCTAGG + Intronic
1141293142 16:82739399-82739421 CTGAAGTGGAATAAGACTCAGGG - Intronic
1142786746 17:2230280-2230302 CCGACATGGACTTATTCTGAAGG - Intronic
1149057708 17:52385472-52385494 CTGATATGAAATAATACTCCAGG - Intergenic
1149333914 17:55614913-55614935 CTGACAAAGAAAAATATTGAAGG - Intergenic
1149727793 17:58914106-58914128 TTGACATGGAAAAATTATGATGG - Intronic
1155805614 18:30167665-30167687 CTGACATAGAATAACCATGATGG - Intergenic
1156793599 18:41010529-41010551 CTGGCATTGAAGAATACTTATGG + Intergenic
1157100588 18:44725553-44725575 CTGACAGTGAATAGCACTGATGG + Intronic
1159282296 18:66301722-66301744 ATGAAATGGACTAATACAGAGGG + Intergenic
1160381475 18:78459981-78460003 GTGACATGGGATAATATTGCTGG + Intergenic
1164102170 19:22066261-22066283 GTGACATGAAAAAATACTGCTGG - Intronic
1167082761 19:47288521-47288543 CCCACACTGAATAATACTGATGG + Intergenic
928404179 2:31001938-31001960 CAGAAATGAAATAATAATGATGG + Intronic
928645690 2:33350299-33350321 CTGATGTGGTATCATACTGAAGG + Intronic
929207663 2:39315754-39315776 CTGACATCGAGAAATTCTGAAGG + Intronic
931017928 2:58007065-58007087 CTGAGAAGGAAGAATATTGATGG - Intronic
933650113 2:84843641-84843663 CTCACATGGAAGAAGACAGAAGG + Intronic
938053586 2:128196681-128196703 CTCACAGGGAATAAAACAGAAGG + Intergenic
940712365 2:157177765-157177787 CTTACATGGAAACACACTGACGG - Intergenic
940818699 2:158326960-158326982 CTGACATGGAACAATATGTAAGG - Intronic
942344827 2:174991604-174991626 TTGACATGAAACAATACTGCAGG + Intronic
942532461 2:176926394-176926416 CTAAAATTGGATAATACTGATGG - Intergenic
942587348 2:177496190-177496212 CTGATATGAAATAATCCTTAAGG - Intronic
943469624 2:188277406-188277428 CTGAAATAGAAGAAAACTGAGGG + Intergenic
1173978668 20:47206407-47206429 CTGATATGGATCAATACTCAAGG + Intergenic
1174958768 20:55131618-55131640 GCAACATGGAATAATACTGAAGG + Intergenic
1176069514 20:63218790-63218812 CTGACATGGAAGGAGACTGGGGG + Intergenic
1179301597 21:40116488-40116510 CTGTCATGGAATCATACGGCTGG - Intronic
1182818067 22:33185874-33185896 CTGACATGAAAGAATATTAAGGG + Intronic
1182954185 22:34405931-34405953 ATTGCATGGAAAAATACTGAAGG + Intergenic
1183049679 22:35250715-35250737 CTCACATGACATAACACTGAAGG + Intergenic
949760166 3:7461865-7461887 CTGATATCCAATAATAATGATGG + Intronic
951698585 3:25471308-25471330 CTGACGTGGAAGAGTACTGAGGG + Intronic
953550653 3:43899961-43899983 CTGAGCTGAAATAATACAGAAGG - Intergenic
956830615 3:73044032-73044054 CTGACATGGATTAAGCTTGATGG - Intronic
957473613 3:80694357-80694379 CTGAGAGGGAAAACTACTGAAGG - Intergenic
957588455 3:82163080-82163102 CTCACATGGCATAAGACAGAGGG - Intergenic
960307301 3:116077594-116077616 GTGAAATACAATAATACTGAAGG - Intronic
960709912 3:120517829-120517851 CAGATTGGGAATAATACTGAAGG - Intergenic
963392040 3:144677267-144677289 CAAACATGGAATAATTCTTATGG + Intergenic
965042490 3:163528282-163528304 TTGACATGTAATATTGCTGAGGG + Intergenic
971842913 4:31877600-31877622 GTCACATGGAATTATCCTGATGG + Intergenic
972236248 4:37137293-37137315 CTGTAACGGAATAATACAGATGG - Intergenic
973047830 4:45556506-45556528 CTCAAGTGGAATAATACTAAAGG - Intergenic
974625594 4:64423962-64423984 CCGATAAAGAATAATACTGAAGG + Intergenic
974759752 4:66259642-66259664 TTGAGATGGAATGATACTGGAGG - Intergenic
975989262 4:80240204-80240226 CTGAGAGGCAATCATACTGAAGG - Intergenic
976014103 4:80529036-80529058 CTGACATGGAGAAATTTTGAAGG - Intronic
977082000 4:92542135-92542157 CTGATATGGTATAATAATTATGG + Intronic
977647702 4:99432546-99432568 TTGACATCAAATAGTACTGAGGG + Intronic
977668140 4:99664776-99664798 CAGACATGGAAGAATTCTGTTGG - Intergenic
978601948 4:110437837-110437859 CTGAAAAGGAATAAAACAGAGGG + Intronic
978624948 4:110674705-110674727 CTAACATGGAAAAATGCGGAAGG - Intergenic
982021113 4:151205516-151205538 CTGACATGTGATTATACTCATGG - Intronic
982989240 4:162249881-162249903 CTGACTTGGAATAATTTTGATGG - Intergenic
983886387 4:172984990-172985012 CTTACATAAAATAATACTGATGG + Intronic
983970769 4:173870291-173870313 CTGTCATTGAAGAATAATGAAGG + Intergenic
984075255 4:175169065-175169087 CTGACATAGAACATTACAGAAGG + Intergenic
987766170 5:22234019-22234041 CTGACATGGAAAAATTATGAAGG + Intronic
993005711 5:82426129-82426151 GTCACATGGAAAAATAATGAGGG + Intergenic
994426066 5:99588481-99588503 ATGACATGCAATCTTACTGACGG + Intergenic
995965366 5:117900467-117900489 TTGACATGGATAAATATTGATGG + Intergenic
996438492 5:123461988-123462010 CTGTCATGGATTATTAATGATGG + Intergenic
996996326 5:129700779-129700801 ATGACATGGAAAAAGTCTGATGG + Intronic
997917426 5:137942052-137942074 TTGAAATGGTAAAATACTGAAGG + Intronic
998483029 5:142478781-142478803 CTGAGATGGAGGAAAACTGAGGG - Intergenic
999210023 5:149880077-149880099 CTGACATGGAAGAGTAATAATGG - Intronic
999221287 5:149980375-149980397 CTGAGATGTAAGAATAGTGAAGG - Exonic
999876296 5:155810240-155810262 CTGACAAGAAATAAAAATGAAGG - Intergenic
1000206871 5:159069472-159069494 ATGACATGGATGAATACAGATGG - Intronic
1001938491 5:175724346-175724368 CTGGTATGGAAGAATAATGATGG - Intergenic
1003541589 6:7023071-7023093 CTCACATTCAATAATATTGAAGG + Intergenic
1005741289 6:28793361-28793383 CTCACATGGCAGAAAACTGAAGG - Intergenic
1010685085 6:78845067-78845089 CTGACAGGGAATAAAATTCAGGG - Intergenic
1012544061 6:100396244-100396266 CTAGCTTGGAATAACACTGATGG - Intronic
1012995567 6:105969795-105969817 CTGAAATGGGATGATAATGATGG - Intergenic
1014876519 6:126667600-126667622 CTGACATGGATAAATACACATGG + Intergenic
1015900062 6:138055363-138055385 GGGACATGGTATAATACTAAAGG + Intergenic
1017563856 6:155663127-155663149 CTGAGATGCAAGAATATTGAAGG - Intergenic
1018373450 6:163189073-163189095 CTGAGATGGAATGATACTGCAGG + Intronic
1020742610 7:12040880-12040902 CTGACCTGAAAGAATACAGAGGG + Intergenic
1020875648 7:13690255-13690277 CTTACATTTTATAATACTGATGG - Intergenic
1020981874 7:15079249-15079271 CTGTCATCAAATTATACTGAGGG - Intergenic
1021074380 7:16283614-16283636 CTGAAATGGAATAATTTTGGGGG + Intronic
1023788403 7:43731462-43731484 ATCACAAGGAATAAAACTGATGG + Intergenic
1024130502 7:46347704-46347726 CTGACATGGAAATAAATTGAGGG + Intergenic
1024802514 7:53097156-53097178 AAAACATTGAATAATACTGATGG - Intergenic
1024881087 7:54086192-54086214 CTTACCTTGAATTATACTGATGG + Intergenic
1025779784 7:64591029-64591051 GTGACATGAAAAAATACTGCTGG - Intergenic
1026444777 7:70474722-70474744 CTGACAGGGAATAAAACTAAAGG - Intronic
1027649523 7:80848482-80848504 TGGACATTGAATAACACTGAAGG + Intronic
1028509900 7:91612688-91612710 CTCACATGGCAAAAAACTGAGGG + Intergenic
1030058641 7:105605366-105605388 CTGCCAAGGAAGAATACTGTGGG + Exonic
1034835406 7:154347074-154347096 CTGACATGGAATAACATTACAGG - Intronic
1035495218 7:159319456-159319478 CTGACATGTAATTATACTCCGGG + Intergenic
1037000834 8:13716676-13716698 TTGACCTGGAATAGTACTGGAGG + Intergenic
1038923437 8:32111550-32111572 CTGACATGGAACAAGACAGAAGG - Intronic
1039020041 8:33195187-33195209 GTGACATGGCAAAATACAGAAGG + Intergenic
1040713306 8:50216162-50216184 CTTACATGGAAAGATACAGAAGG - Intronic
1040739192 8:50551340-50551362 CCTACATAGAATAATTCTGAGGG - Intronic
1042098270 8:65243447-65243469 CTGTAATGAAATAATACTTAAGG + Intergenic
1043450772 8:80363946-80363968 CTGAAATGGAAGAAAACTGAGGG + Intergenic
1044410892 8:91881466-91881488 CAAACATGAAATAATAATGATGG + Intergenic
1045123198 8:99061109-99061131 TTGAGATGGCATAAAACTGAAGG - Intronic
1045350176 8:101331192-101331214 CTGACAGGGTAGAATACAGAGGG - Intergenic
1046240825 8:111488959-111488981 CTAACATGAAATTATATTGATGG + Intergenic
1046307181 8:112384660-112384682 CTTGCATGGAAGAATAATGATGG - Intronic
1047583438 8:126242464-126242486 GTGACATGGAAGAGCACTGAGGG - Intergenic
1048998406 8:139808506-139808528 CTGAAATGTAATAATGCTGATGG - Intronic
1050020669 9:1281411-1281433 CTGACAAGAAATTATACAGAAGG - Intergenic
1051896128 9:21990825-21990847 CTGACAAAGATTAATACAGATGG - Intronic
1052592868 9:30521145-30521167 CTGAGATGAAATAAGACAGATGG - Intergenic
1052677138 9:31641437-31641459 CTGAAATGGAATAAGAATGAAGG - Intergenic
1052856771 9:33411996-33412018 ATGACATGAAAAAATAATGATGG - Intergenic
1054963386 9:70994624-70994646 CAGAAAGGGAAAAATACTGAAGG - Intronic
1062739328 9:138159482-138159504 CTTACACTGACTAATACTGAAGG - Intergenic
1186379397 X:9041884-9041906 CTGACATTGAGAAATACTGCTGG + Intronic
1188139788 X:26535351-26535373 CTCCCATGGAATAAGGCTGAAGG + Intergenic
1188526443 X:31093223-31093245 GTGGCATGGAATGAGACTGAAGG - Intergenic
1188770906 X:34153076-34153098 CTCACATAGAATAAAAGTGAAGG - Intergenic
1190897762 X:54638429-54638451 CTGACATGGAAAGATATCGAAGG - Intergenic
1194928497 X:99858728-99858750 CTGATATGGTATATTACAGATGG - Intergenic
1195392848 X:104381147-104381169 ATGACATGGAATAAGATCGAAGG - Intergenic
1196261132 X:113583006-113583028 CTCACATGGACTAATATAGAGGG + Intergenic
1197317777 X:124989567-124989589 TTGACAAAGAATAATATTGAAGG + Intergenic
1197570118 X:128139880-128139902 CTTAAATGGAATGAAACTGAAGG - Intergenic
1198159458 X:133992423-133992445 CTGACATGGACAAATACTTTGGG - Intergenic