ID: 913355869

View in Genome Browser
Species Human (GRCh38)
Location 1:117921579-117921601
Sequence TAGGAAAAGCAGAATAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 375}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913355869 Original CRISPR TAGGAAAAGCAGAATAAGCT AGG Intronic
900651295 1:3731249-3731271 GAGGAAAAGCACAAAAAGCCGGG + Intronic
907458569 1:54591877-54591899 TTGGAACCTCAGAATAAGCTTGG - Intronic
908109109 1:60877019-60877041 TAGGGAAAGCAGATTAATATGGG - Intronic
908330484 1:63066032-63066054 TCGGAAAAGCAGAATCACCATGG + Intergenic
910263133 1:85311026-85311048 ATTGAAAAGAAGAATAAGCTTGG - Intergenic
911210085 1:95129792-95129814 GAGGAAAAGAAGACCAAGCTAGG - Intronic
911426589 1:97722372-97722394 TAAGAAAATCTGAATAAACTAGG + Intronic
911438369 1:97892677-97892699 TTGGAAAAGTAGAACAACCTAGG - Intronic
911941208 1:104049905-104049927 TTGGAAAAGAAGAATAAAGTGGG + Intergenic
913007783 1:114651799-114651821 TAGGCAAAGCAGAGTAAGTAAGG + Intronic
913355869 1:117921579-117921601 TAGGAAAAGCAGAATAAGCTAGG + Intronic
913439048 1:118878044-118878066 TAGGAAAAGCAGATTGAGATTGG + Intergenic
914256468 1:145964092-145964114 TGGAAAATGCAGAAAAAGCTGGG + Intronic
915427528 1:155839351-155839373 TAGGAAAAGTAGTATAGGCCAGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916609237 1:166374059-166374081 TAAGAAAAGCAGAATAGGCTGGG - Intergenic
917271197 1:173276467-173276489 AGGGAAAAGCACACTAAGCTGGG + Intergenic
917695600 1:177520082-177520104 AAAGAAAAGCAGAATGAGCCTGG + Intergenic
918582942 1:186153661-186153683 TATGAAATGCAGAATGAGCGGGG - Intronic
918737095 1:188078415-188078437 TAGGAAAAAAAAAATAACCTAGG + Intergenic
919182170 1:194100561-194100583 TAGAAAAACAAGAATAGGCTGGG - Intergenic
920023456 1:202973853-202973875 TTGGAAAAGAAGAATAAAGTTGG - Intergenic
921878820 1:220230372-220230394 TAGGAAAAGCAGAATAGCTGAGG + Intronic
922316050 1:224443118-224443140 TAGGGATAGCACACTAAGCTAGG + Intronic
923305513 1:232684761-232684783 TGGGAGAAGCAGATGAAGCTTGG - Intergenic
923700662 1:236297187-236297209 TAGGAAGAGCTGTAGAAGCTTGG + Intergenic
1064591338 10:16894640-16894662 TTGGAAAAGAAGAATAAAATGGG - Intronic
1065703829 10:28451560-28451582 TTGGAAAAGAAGAATAAAGTAGG - Intergenic
1066024434 10:31340246-31340268 TACCAAAAGCAGGATATGCTTGG - Intronic
1069179075 10:65333357-65333379 AAGGAAAATCAAAATAAGCCTGG - Intergenic
1070024447 10:72618639-72618661 TAGAAAAAGCACAAGAAACTTGG + Intronic
1070054979 10:72925768-72925790 TAGAAAAAAAAGAATTAGCTGGG - Intronic
1070363006 10:75708798-75708820 TGGGAAAAGCAGACAAAACTGGG - Intronic
1071130171 10:82381758-82381780 TTGGAAAACAAGCATAAGCTGGG + Intronic
1071579833 10:86758701-86758723 CAGGAAAAGCAGACTACACTTGG - Intronic
1071980651 10:91001380-91001402 TAGAAAAGACAGAATAAGTTAGG - Intergenic
1072365137 10:94701756-94701778 AGGGAAAAGCACACTAAGCTGGG + Intronic
1072643868 10:97236270-97236292 TAGAAAAGGCAGAAGAGGCTGGG - Intronic
1073713060 10:106067805-106067827 TATGAAAAGCTAAATAAGCAAGG + Intergenic
1073810104 10:107143486-107143508 AAAGAAAAGAAGAATTAGCTGGG - Intronic
1073982483 10:109170441-109170463 TAAGAAAAGAAAAAAAAGCTGGG - Intergenic
1074575281 10:114663119-114663141 CAGGAAAAGCAAAAGAAGCAGGG - Intronic
1074620522 10:115115104-115115126 TAGGTTATGCAAAATAAGCTAGG + Intronic
1074789679 10:116874426-116874448 TAGGAAAAACACAATTACCTAGG + Intronic
1077128675 11:957771-957793 TAAGGAAAGCAGATGAAGCTAGG - Intronic
1077344991 11:2043204-2043226 TAGAGAAAGGAGAATAAGATTGG - Intergenic
1079370901 11:19851421-19851443 TGGGATAAGAAGAATAAGCATGG + Intronic
1079779045 11:24575254-24575276 TAAGAAAAGCAGAATTAGAAAGG - Intronic
1080163403 11:29207012-29207034 TATGTTAAGCAAAATAAGCTTGG + Intergenic
1080495606 11:32815494-32815516 TTAGAAAAGCAAAATAGGCTGGG - Intergenic
1081146937 11:39572874-39572896 TTTTAAAAGCAGAATAAGCTTGG + Intergenic
1081409732 11:42743366-42743388 TAGAAAAAGAAAAATAGGCTGGG - Intergenic
1081602947 11:44507902-44507924 GAGGAAAAGGAGAATAGGCATGG + Intergenic
1083022572 11:59522011-59522033 TAGAAAAAACAAAATATGCTAGG - Intergenic
1083052207 11:59787467-59787489 TAGGAAAAGCAGTTCAGGCTGGG - Intronic
1083567671 11:63733719-63733741 AAGGAAAAGAAAAATTAGCTGGG + Intronic
1086138817 11:83471580-83471602 TAGGAAAAACAAAAAGAGCTTGG - Intronic
1086556497 11:88117305-88117327 TAGCAAAAGCATAAAAAGGTTGG + Intronic
1086889474 11:92239853-92239875 TAGGAAAGGCAAGAAAAGCTGGG - Intergenic
1087855280 11:103085142-103085164 TAGAAACATCAGCATAAGCTAGG + Intronic
1088530466 11:110802649-110802671 GAGGCAAAGCAGAGTAAACTAGG - Intergenic
1089789883 11:120934891-120934913 ATGGAAAACCAGAAAAAGCTGGG - Intronic
1091437807 12:486500-486522 TAAGAAAAACAGAATAGGCCGGG - Intronic
1092655763 12:10683405-10683427 CAGCAAAAGCAAAATTAGCTGGG - Intergenic
1094235572 12:28162023-28162045 TAGAAAAAGCTGACGAAGCTTGG - Intronic
1094464932 12:30743017-30743039 CAAGAAAAGCAGCATCAGCTGGG + Intronic
1095787910 12:46131009-46131031 TTGGGAAATCAGAATAAGATAGG + Intergenic
1095865154 12:46963881-46963903 AAATAAAAGCAGAATAGGCTAGG - Intergenic
1096245493 12:49982969-49982991 TAGGAAAAGCAGAGAAACCAAGG - Intronic
1097424125 12:59420632-59420654 ACAGAAAAGCAGAAGAAGCTTGG + Intergenic
1097580268 12:61447298-61447320 TGGGAAAAGCAGAGAAATCTTGG - Intergenic
1097713720 12:62942850-62942872 TAGGAAAACCAAAATATTCTTGG + Intergenic
1098317269 12:69206001-69206023 TAGGCTAAGCAAAATAAACTAGG - Intergenic
1099172909 12:79386609-79386631 TAATAAAAGCAAAATAAGCATGG - Intronic
1100224380 12:92541307-92541329 AAGGAAAAGAAGAATAAATTAGG - Intergenic
1100667234 12:96768355-96768377 TAAGAAGAGCATAATAGGCTGGG + Intronic
1101498359 12:105277556-105277578 CATGAAAAACAGAATAATCTTGG - Intronic
1101766125 12:107701023-107701045 TAAGAAATGCAGATTAAGCCAGG - Intronic
1102960664 12:117091382-117091404 TAAGACAAACAGAATAACCTGGG - Intronic
1103290248 12:119839782-119839804 TAGGAGAAGAAAAATAAACTTGG + Intronic
1103898164 12:124288058-124288080 CAGGAAAGGCAAAATAGGCTTGG + Intronic
1104574200 12:129951757-129951779 AATGAAAACCAGAATCAGCTAGG + Intergenic
1105947226 13:25200536-25200558 TATGAAAAGCAGAATAGGGCCGG - Intergenic
1106013796 13:25849101-25849123 GAGGAAAAGCAGGAGAAACTTGG + Intronic
1109505121 13:63290183-63290205 AAGGAAAAGCAGAAAAAGTAAGG + Intergenic
1109788223 13:67210853-67210875 TATAAAAATCAGAATAAGCAAGG + Intronic
1110874539 13:80492035-80492057 TAGGGTAAGCAAAATAAGCCAGG - Intergenic
1111560243 13:89935308-89935330 TAGCAAAAGCAGGTTAAGCAAGG + Intergenic
1112589480 13:100750270-100750292 TAGGCACAGCAGAATCACCTGGG + Intergenic
1113745050 13:112738492-112738514 TAGGAAAAGCAATGTGAGCTGGG + Intronic
1114797607 14:25734398-25734420 TGGAAAAAGCAGGATAGGCTGGG - Intergenic
1115007465 14:28502898-28502920 TAAGAAAAGCCGAATAAAGTGGG + Intergenic
1115831752 14:37350370-37350392 AAGAAAAAGCAGAATGGGCTGGG - Intronic
1116962582 14:50981859-50981881 TAGGAAAAGACGACAAAGCTTGG - Exonic
1117149623 14:52872258-52872280 TTAGAAATGCAGAATCAGCTTGG + Intronic
1117662183 14:58018995-58019017 TATGTTAAGCAAAATAAGCTAGG + Intronic
1118259150 14:64231401-64231423 TAGTACAGGCAGGATAAGCTTGG - Intronic
1118712827 14:68536747-68536769 TAGGAAAAGCAGCAAAAGGGGGG - Intronic
1118920903 14:70149268-70149290 TGGGAAAAGCAGAATCAGGCTGG + Intronic
1120466858 14:84869395-84869417 TAGGAAAAGTAGAAAAAGGTAGG - Intergenic
1121487493 14:94329985-94330007 TTGGAAAAAGAGAAAAAGCTAGG + Intergenic
1123111419 14:105868827-105868849 TGGGAAAAGCTGAAAAAACTTGG - Intergenic
1123583786 15:21739526-21739548 TAGAAAAAAAAGAATTAGCTGGG + Intergenic
1123620436 15:22182129-22182151 TAGAAAAAAAAGAATTAGCTGGG + Intergenic
1124087896 15:26568808-26568830 TAAGAAAAGCAAAATAGGCCGGG - Intronic
1124116357 15:26846836-26846858 TATGAAAAGCAAAATCAGCGGGG - Intronic
1124270635 15:28277307-28277329 TGGGAAAATCTGAATAAGATAGG + Intronic
1124902474 15:33837191-33837213 TAGGAAAGCCAGAATGAACTGGG + Intronic
1125458801 15:39888587-39888609 TAAGAGGAGAAGAATAAGCTGGG - Intronic
1125882153 15:43204292-43204314 GAGGAAAAGCAGAGTAAGGGAGG - Intronic
1126561084 15:50044981-50045003 GATGAAAAGCAGAAAAAGATGGG - Intronic
1126672866 15:51132257-51132279 GAGGAAAAGGACAAGAAGCTGGG - Intergenic
1129001365 15:72337338-72337360 TAAGAAGAGAAAAATAAGCTGGG - Intronic
1129553505 15:76479560-76479582 TAGGAAAAGCATCATAAAATTGG + Intronic
1129602227 15:77006885-77006907 TTGAAAAAGAAGAATAAGTTTGG - Intronic
1129999188 15:80032555-80032577 TAGGAAAAGCAGTTAAGGCTGGG - Intergenic
1133652113 16:7822327-7822349 AAGGAAGAGCAGAAAGAGCTGGG - Intergenic
1135381870 16:22002488-22002510 CAGAAACAACAGAATAAGCTTGG - Intergenic
1137910126 16:52369483-52369505 TGAGAAAAGCAGATTGAGCTGGG - Intergenic
1138055685 16:53830733-53830755 TAGAAATAGAAAAATAAGCTGGG + Intronic
1138853896 16:60664078-60664100 TAGGAATAACAGAATAGGCTGGG + Intergenic
1138867807 16:60845063-60845085 TAGGAAGAACTGAATAACCTAGG - Intergenic
1139417327 16:66824030-66824052 TAGGAGAAGCAGAATTGGCTGGG - Intronic
1139583602 16:67887099-67887121 AAGGAAGAGCAAAATCAGCTAGG + Intronic
1139788564 16:69413761-69413783 TAGAAAAGGGAAAATAAGCTAGG - Intergenic
1140570453 16:76099730-76099752 TAAGAAAAACAGAAAAAGCATGG - Intergenic
1140784093 16:78323478-78323500 TAGAAAAAGCAGAAACTGCTGGG - Intronic
1141022799 16:80513472-80513494 TAGGTAAAGGAGGAAAAGCTGGG + Intergenic
1143297045 17:5878926-5878948 TAGGGAAATCTGAATAAGTTAGG + Intronic
1145093939 17:20009002-20009024 CAGGAAAAACCGAATAGGCTGGG + Intergenic
1146301163 17:31690921-31690943 CAGTAAAGGCAGAATAGGCTGGG - Intergenic
1146317925 17:31822999-31823021 TAGGAAAGGCTGAATAGGCTGGG - Intergenic
1146832464 17:36081763-36081785 TAGGAAAAGCAGCAGATGCCTGG + Intergenic
1146846944 17:36188080-36188102 TAGGAAAAGCAGCAGATGCCTGG + Intronic
1147474783 17:40700364-40700386 TAGGAAATGAAGAATATGCAAGG - Exonic
1148520015 17:48264833-48264855 GAGGAAAATCAGAAGAGGCTGGG - Intronic
1148988851 17:51647858-51647880 GAGAAAAGGCAGAATATGCTTGG + Intronic
1150066433 17:62113511-62113533 TAGAACAAGGAGACTAAGCTTGG + Intergenic
1150385249 17:64754029-64754051 CAGGATAACCAGAATAATCTTGG + Intergenic
1150771403 17:68044457-68044479 CAGGATAACCAGAATAATCTTGG - Exonic
1151623949 17:75264951-75264973 TAGGAAAAGCCCCATTAGCTGGG - Intronic
1153464833 18:5377879-5377901 CAGGAAAAGCAGAGAAAGGTGGG + Intergenic
1154079406 18:11241056-11241078 TTGGAAAAGAACAATAAGGTTGG + Intergenic
1155425856 18:25706825-25706847 AAGGAAAAGAAGGAAAAGCTGGG - Intergenic
1155737833 18:29246189-29246211 GAGGAAATGCAGAGTAAGTTAGG - Intergenic
1156050795 18:32931268-32931290 TAGGAAAATCAGCATAAACCAGG - Intergenic
1156065861 18:33141727-33141749 TAGGAAAAGAAGAAGAGGATTGG - Intronic
1156256352 18:35401022-35401044 TAGAAAAGGCACAATAGGCTGGG + Intergenic
1156725640 18:40123025-40123047 TAGGTAAGGAAGAAAAAGCTTGG + Intergenic
1157903938 18:51549304-51549326 TTGGAAAAGAAGAATAAAATTGG - Intergenic
1159405615 18:67998756-67998778 AAGGAAAAACAAAATAAGTTGGG + Intergenic
1160117026 18:76089009-76089031 TAGCAAATGCAGAATAGGCCAGG + Intergenic
1160154980 18:76426782-76426804 CAGGAAATGAAGAAAAAGCTAGG + Intronic
1160354091 18:78211927-78211949 TCGAAAAAGGAGAATAAGGTTGG - Intergenic
1160574176 18:79840640-79840662 TTGGAAAAGAAGAATAAAGTGGG + Intergenic
1162629852 19:11918840-11918862 AATGAAAAACAGAATAACCTTGG - Intergenic
1162634952 19:11960684-11960706 AATGAAAAACAGAATAACCTTGG - Intronic
1162835710 19:13316320-13316342 GAGGAAAAGCAGCAAAAGATGGG - Intronic
1163134645 19:15301042-15301064 TGAGAAATGCAGAAAAAGCTGGG + Intronic
1163951590 19:20592722-20592744 CAGAAAAAGCAGAATGGGCTGGG - Intronic
1163965025 19:20738373-20738395 CAGAAAAAGCAGAATGGGCTGGG + Intronic
1164283981 19:23793925-23793947 TACGAAAAGAAAAATTAGCTAGG - Intronic
1165039141 19:33056585-33056607 TAGGAAGAGCATAAAAATCTGGG + Intronic
1166842923 19:45709924-45709946 TAGTAAAAGCAATATAATCTTGG + Intergenic
1167375540 19:49108971-49108993 GAGGAAAGGCAGAATACACTGGG + Intergenic
1168137908 19:54364089-54364111 TAAGAAAAGCAAAATAAGACAGG + Intronic
925073625 2:991511-991533 TATGGAAAACAGAATAAGCCAGG - Intronic
925702590 2:6653823-6653845 TAGTAAAACCAGAAAAAGCCTGG + Intergenic
926492433 2:13541182-13541204 TAGGAAAAGTGGAATAATATCGG - Intergenic
927919560 2:26961575-26961597 TAGGAGAAGCACCATAACCTGGG - Intergenic
929556414 2:42928333-42928355 CAGGACAAGCAGAATGGGCTGGG - Intergenic
930362000 2:50392821-50392843 TATTAAAAGCAAAATGAGCTTGG + Intronic
931653758 2:64491394-64491416 TGGGAAAAGCAGAATTAGAAAGG + Intergenic
932557795 2:72840906-72840928 CATGAAGAGCAGAATAGGCTGGG - Intergenic
934481466 2:94650111-94650133 TAAGGAAACCAGAATATGCTGGG - Intergenic
935260172 2:101348239-101348261 TTGTAAAAGCAGAATAAGGTAGG - Exonic
935300742 2:101691897-101691919 TATAAAAAACAGAATAAGCTGGG - Intergenic
935658172 2:105442746-105442768 AGAGAAAAGCATAATAAGCTTGG - Intergenic
936239481 2:110774869-110774891 TTGGAAAAGAAGAATAAAGTTGG + Intronic
937345472 2:121122930-121122952 CAACAAAAGCAGAATTAGCTGGG - Intergenic
937464034 2:122114229-122114251 TAAGAAAAGCAGAATGCTCTGGG + Intergenic
937657574 2:124394074-124394096 TAATAAAAGGTGAATAAGCTGGG + Intronic
938729378 2:134134468-134134490 CAGGAAAAGCAGAATAGGCAGGG - Intronic
939125046 2:138167495-138167517 TATGAAAAGCAAAAAAAGCAAGG + Intergenic
940214717 2:151292666-151292688 TAGCAACAGCAGCATAAGCTTGG - Intergenic
940272526 2:151907168-151907190 TAGGGAAAACAGAACAAGCAAGG + Intronic
940640256 2:156337609-156337631 TAGGCAAAGAAGAATAACTTTGG + Intronic
940752025 2:157636659-157636681 TAGGAAAGTGAGAATTAGCTGGG - Intergenic
940876573 2:158903604-158903626 TAGGTCAAGCAGAAGCAGCTTGG - Intergenic
941010905 2:160298280-160298302 GAGGAAGAGCAGAATTAGATGGG + Intronic
942375109 2:175328647-175328669 TAGGAAAAGCAGAGTGTACTGGG + Intergenic
942776806 2:179591465-179591487 TAAGAAAAGCAGTATTAGCCAGG - Intronic
943293836 2:186111839-186111861 TAGAAAAAGAAGAATAAGCTAGG - Intergenic
943898879 2:193406380-193406402 TAGTAAAAGGATAATAAGTTGGG + Intergenic
944023353 2:195133524-195133546 TAGAAAAATCAGAATAATGTTGG + Intergenic
945696593 2:213114376-213114398 TAGGAAAGGAAGAAAAAACTTGG - Intronic
946361706 2:219222900-219222922 AAGGAAGAGCAGAGTAAGCAGGG + Intronic
946549509 2:220785666-220785688 TAGTAAAATCTGAATAAGGTTGG + Intergenic
946717965 2:222573101-222573123 TAGGAAATACAGAATCAGGTTGG + Intronic
947143684 2:227043460-227043482 TAGGAAAACCAATATAAACTTGG - Intronic
947321935 2:228929319-228929341 TAATAAAAGCAGCATAAGATGGG + Intronic
948669804 2:239560781-239560803 TAGGAACAGCAGAAGAAAATAGG - Intergenic
1168907146 20:1415538-1415560 TGGGAAAATCTGAATAAGATGGG + Intergenic
1169185217 20:3610240-3610262 TAGAAAAAGAAGAATAAAATGGG + Intronic
1169203576 20:3728062-3728084 TAGGAAAATGAGAATAGACTGGG + Intergenic
1169267996 20:4178976-4178998 TAGAAAATGCACAATAGGCTGGG - Intronic
1170533022 20:17313526-17313548 TAGGAAAAGCAGAGAAAGGCTGG + Intronic
1170665189 20:18380602-18380624 TATGAAAAAAAGAAAAAGCTCGG - Intergenic
1172441015 20:34966651-34966673 TGGGAAAATCTGAATAAGATCGG + Intergenic
1173327151 20:42044383-42044405 TTGGAAAACCAGAATGAGCCTGG - Intergenic
1173698725 20:45046973-45046995 TAAGAAAAGCAAATTAGGCTGGG - Intronic
1175423354 20:58849852-58849874 TAGGAAAAGCAGAAGCAGCATGG - Intronic
1175458895 20:59136029-59136051 GATGACAAGCTGAATAAGCTTGG - Intergenic
1176878516 21:14162468-14162490 TAGGAAAATCTGATTAAGATGGG + Intronic
1178330179 21:31683310-31683332 TTGGAAAAACATAGTAAGCTAGG - Intronic
1178535558 21:33407555-33407577 TAGGAAGAGCCAAATAATCTAGG + Intronic
1178877635 21:36425012-36425034 TAGGAAGAGCAATATGAGCTGGG - Intergenic
1180848259 22:18996217-18996239 TAAGAAATGCATAATAAGGTGGG + Intergenic
1182453132 22:30432923-30432945 GAGGAGAAGCAGGAAAAGCTAGG - Intergenic
1183491202 22:38116557-38116579 TAGAAAAAGGAGAATCGGCTGGG + Intronic
1183575720 22:38687598-38687620 TAGAAAAGGGAAAATAAGCTAGG + Exonic
1184580301 22:45412799-45412821 TAGGAAAAGCTCAGTAAACTGGG + Intronic
1185035534 22:48474779-48474801 AAGGAAAAGCAGAAAAAGCAGGG + Intergenic
949176973 3:1075750-1075772 TAAAAAAAGCAGGATAAGCCAGG - Intergenic
949187801 3:1214727-1214749 AAGAAAACTCAGAATAAGCTGGG - Intronic
949835923 3:8269948-8269970 TAGGAAAAGGACAATAAGTTGGG - Intergenic
950576013 3:13832454-13832476 GAGGAAGAGCAGGAGAAGCTTGG - Intronic
951104507 3:18727408-18727430 AAGGAAAATCAGAAAATGCTTGG + Intergenic
951265037 3:20554923-20554945 TAGGAAATGTAGAAGAAGGTAGG + Intergenic
952121354 3:30248708-30248730 TAGGAGAAGAAGAATGAGATAGG - Intergenic
952307198 3:32156780-32156802 GATGAAAAACAGAATGAGCTGGG - Intronic
952774298 3:37029987-37030009 TAAGAAAAGAAAAATTAGCTGGG - Intronic
952861681 3:37818086-37818108 TATCAAAAGCCAAATAAGCTTGG + Intronic
953208073 3:40849579-40849601 TATGAAAGGCAGAATAGGGTAGG + Intergenic
953215870 3:40917525-40917547 AAGGGAAACAAGAATAAGCTGGG - Intergenic
953325821 3:42011831-42011853 TGGGAAAATCTGAATAAGATAGG - Intergenic
954813859 3:53265133-53265155 TGGGAAAAGCAGATCCAGCTAGG + Intergenic
956077268 3:65518884-65518906 GAGAAAAAGCAGAATAAGAGTGG + Intronic
956927758 3:74007823-74007845 TAGGAAAACCAGAATGAAGTGGG + Intergenic
959179385 3:102959316-102959338 TATGTTAAGCAAAATAAGCTAGG - Intergenic
962049618 3:131799190-131799212 TAGGAAAGACACAATTAGCTGGG + Intronic
963325103 3:143853533-143853555 TAGGAGAAGCTGAATACGCTTGG + Intergenic
963814716 3:149816631-149816653 TAGGAAAAGCAGAATACATTTGG + Intronic
964172368 3:153785927-153785949 AAGGAGGAGCAGAATAAACTGGG + Intergenic
964555112 3:157928599-157928621 AAGGTAAAACACAATAAGCTGGG - Intergenic
965211836 3:165800496-165800518 TAGGAAAAGCAGAGAAACCCTGG - Intronic
965488974 3:169313574-169313596 AAGGAAAGGCAGAATAAGAGGGG + Intronic
965900038 3:173628311-173628333 TAGTAAACGAAGAATAAGGTGGG - Intronic
965943109 3:174209218-174209240 TAGGAAATACAGAATTAGGTCGG - Intronic
965998165 3:174912396-174912418 TAGGAATAGCAGAACAAATTAGG + Intronic
967516639 3:190377179-190377201 GAGGAAAAGAAGAACCAGCTTGG + Intronic
967533351 3:190574514-190574536 TTGGAAAAGGAGCAAAAGCTAGG - Intronic
969464337 4:7346100-7346122 TAGAAAAAGAAAAATAAGCCTGG - Intronic
970153725 4:13119192-13119214 AAGAAAAAGCAGAATAAAATGGG - Intergenic
974381770 4:61149707-61149729 TAGGAAAAGCCGGATAATCAAGG - Intergenic
974871190 4:67645303-67645325 TAAGAAATACAGAATAGGCTGGG + Intronic
974968248 4:68791693-68791715 TAGGAAAAGAAGAATCACCTTGG + Intergenic
975929555 4:79502747-79502769 TAGAAAAAGTAGAATAAAATGGG + Intergenic
975974633 4:80080833-80080855 CAGGATAACCAGAATAACCTTGG - Intronic
976428448 4:84933792-84933814 TATGTTAAGCAGAATAAGCCAGG - Intronic
978515131 4:109560730-109560752 TGGGAGCAGCAGAATAACCTGGG + Intronic
980408713 4:132386553-132386575 TAGGAAAAACAGTATAAACTAGG + Intergenic
980900825 4:138903693-138903715 TAGGAAAAACAAAAGAAGCTGGG + Intergenic
981306411 4:143251209-143251231 TACAAAAAGCAGACTGAGCTAGG - Intergenic
981945663 4:150340628-150340650 TATGAAAAGCACTTTAAGCTGGG - Intronic
982718987 4:158839887-158839909 TGGAAAAAGCAGCACAAGCTGGG + Intronic
983926849 4:173412015-173412037 CAGGAGTAGCAGAACAAGCTGGG - Intergenic
984704545 4:182838228-182838250 TAGGAAATACAAAATTAGCTGGG - Intergenic
986358176 5:6949325-6949347 TGAGAAAATAAGAATAAGCTGGG - Intergenic
986991999 5:13564989-13565011 TAAGAAAATCAGAATAAAGTAGG + Intergenic
987901248 5:24014648-24014670 CAGGAAAAGCAGAAGCAGTTCGG - Intronic
988306185 5:29497610-29497632 TGGGAAAAATAGAATAAACTTGG - Intergenic
988514716 5:31894571-31894593 TTGGAAAAGCAAAATATACTTGG - Intronic
988584245 5:32495053-32495075 TAGGGAATGGAGAATAAGATGGG + Intergenic
990039981 5:51367829-51367851 TGGGAACTTCAGAATAAGCTTGG + Intergenic
990292441 5:54366420-54366442 TAAGAAAAACATAATAAGCCAGG + Intergenic
990660220 5:58005700-58005722 TAGGAAATACAGGACAAGCTTGG - Intergenic
992457843 5:76932512-76932534 TAGAAAAACAAAAATAAGCTGGG - Intergenic
992794759 5:80245402-80245424 TTGGAAAAGGAGTAGAAGCTGGG - Intronic
994442848 5:99832020-99832042 TAGGAAAAGTAAAATAAGACAGG + Intergenic
996185954 5:120475574-120475596 TAAGAAATGAAAAATAAGCTGGG + Intronic
998001467 5:138629311-138629333 TAGTGAAAGGAGGATAAGCTAGG - Intronic
999786707 5:154897181-154897203 TAGGAACAGCAGAATAAAAATGG - Intronic
1000595014 5:163205167-163205189 TAGGAAAAGTTGAACAAGATTGG + Intergenic
1001812044 5:174636182-174636204 TAGGAAGAGGAGGATCAGCTAGG + Intergenic
1002083551 5:176752818-176752840 TTGAAAAAGAAGAATAAGATGGG + Intergenic
1002308088 5:178296120-178296142 GAGGAAAGGCAGCAAAAGCTGGG - Intronic
1002607186 5:180390358-180390380 GAGGAGAAACAGAAGAAGCTCGG - Intergenic
1003012197 6:2436437-2436459 TAAGAAAAACAGAGAAAGCTGGG + Intergenic
1003383536 6:5646911-5646933 TAGGAAAAGCAAAATATAGTTGG - Intronic
1003423074 6:5975342-5975364 AAGAAAAAGCAGATTGAGCTGGG + Intergenic
1003745514 6:8997152-8997174 AAGGAAAAGGAGAAGGAGCTAGG + Intergenic
1004166681 6:13262875-13262897 AAGGAAAAACAGAATTAACTTGG - Intronic
1004178604 6:13362165-13362187 TAGAAGAACCAGAATCAGCTGGG + Exonic
1006092262 6:31635030-31635052 GAGAAAAAGCAGAAAAAGGTAGG - Intronic
1007858075 6:44878891-44878913 TAGGAAAAGCATAGTTATCTGGG - Intronic
1008930109 6:56930551-56930573 TAGGAAAAGAAGCAAAAGCAAGG - Intronic
1009388381 6:63114542-63114564 TGTTAAAAGCAGAATAATCTTGG + Intergenic
1010242502 6:73629475-73629497 TAAGAAAAGAAGAAGAAGCCGGG + Intronic
1011007656 6:82665245-82665267 GAGGAAAACCAGATGAAGCTAGG + Intergenic
1011493359 6:87915239-87915261 CAGAAGAAGCAGAACAAGCTGGG - Intergenic
1012445812 6:99306187-99306209 CCTGAAAATCAGAATAAGCTTGG + Intronic
1013894385 6:115068135-115068157 TAGGAAGAGTAGAACAAGCATGG + Intergenic
1014747099 6:125213488-125213510 AAGGCAAAGCTGAATCAGCTCGG - Intronic
1015061442 6:128971665-128971687 TAAGAAAAGCTGAAAAAGGTAGG + Intronic
1015427210 6:133085105-133085127 TAGCAATAGCAGAATAGGGTTGG + Intergenic
1017049021 6:150373015-150373037 TGGGAAAAGAAGAAAAAGATAGG + Intronic
1019056548 6:169227644-169227666 AAGGCAAGGCAGAATAAGCATGG + Intronic
1022068137 7:26882536-26882558 TAAAAGAAGCAGAATAGGCTGGG + Intronic
1022264759 7:28743077-28743099 TAGTAAAAGCAAAATAAGCTGGG - Intronic
1022823599 7:33986287-33986309 TAGGAAAAGTAGAAAGAGATGGG - Intronic
1022906931 7:34866745-34866767 AGGGAAAAGGAGAGTAAGCTAGG + Intronic
1023276574 7:38525400-38525422 TGGGAGAAGCTGAATAAGATGGG - Intronic
1024991864 7:55241069-55241091 TAGGAAAAGCTGTAAAAGCAGGG + Intronic
1025767674 7:64471763-64471785 TTGGAAAAACAAAATTAGCTGGG + Intergenic
1026315332 7:69222755-69222777 TAGGAAAAAAAAAATTAGCTCGG - Intergenic
1026387809 7:69867965-69867987 TAGGAAATTCAGATTTAGCTGGG + Intronic
1026808332 7:73442051-73442073 TTAGAAAAACAGCATAAGCTTGG + Intronic
1028253574 7:88564991-88565013 CAGGATAACCAGAATAAACTTGG + Intergenic
1029678313 7:102088471-102088493 TAGAAAAACAAGAATTAGCTGGG + Intronic
1030543740 7:110866562-110866584 GAGGAAGAGCAGATTAAACTAGG - Intronic
1030815870 7:114036691-114036713 AAGGAAAGGCAAAATTAGCTGGG - Intronic
1031123634 7:117748754-117748776 TAGGAAAAACAGAAAAAGTTTGG - Intronic
1031520415 7:122757973-122757995 TAGGAAAAGCATCATTATCTTGG - Intronic
1031551058 7:123112058-123112080 TAGGAATAGGAGACAAAGCTAGG - Intergenic
1032738737 7:134717372-134717394 TTGGAAAAGCAGAGTGACCTTGG + Intergenic
1033480711 7:141737722-141737744 TAAGAAAAGCAGAAAAAGAAAGG - Intergenic
1034331527 7:150287319-150287341 AAGGAAAAGCAGAGTCAGGTGGG + Intronic
1034666516 7:152822542-152822564 AAGGAAAAGCAGAGTCAGGTGGG - Intronic
1035632562 8:1119875-1119897 TCCCTAAAGCAGAATAAGCTAGG - Intergenic
1036103145 8:5809688-5809710 TAGGAAAAGCAGAGTGATGTTGG - Intergenic
1036524123 8:9519203-9519225 TAGGAAATGCAGAAGAAACGAGG - Intergenic
1036938639 8:13030442-13030464 AAGGAAAAGCAGCAGATGCTTGG + Intronic
1037807008 8:22063645-22063667 TAGAGAAAGCAGCATAAGGTGGG - Intronic
1037939055 8:22937345-22937367 TACATAAAGCAGAATAAACTAGG + Intronic
1038029303 8:23623107-23623129 TTGGAAAATCATAATTAGCTTGG + Intergenic
1038634263 8:29272713-29272735 TAAGAAAAGAAAAATTAGCTGGG + Intergenic
1038948174 8:32384757-32384779 TAGGCAAAACAAAATAACCTAGG - Intronic
1039497096 8:37988543-37988565 TAGGAACAGGAAAATAATCTTGG - Intergenic
1041406405 8:57504221-57504243 TAGGAAAATCAGAACATGGTTGG + Intergenic
1041563069 8:59242695-59242717 GAGGAAAAGCAGTAGAATCTGGG - Intergenic
1041567733 8:59299489-59299511 GAGGAATAGCTGAAGAAGCTTGG - Intergenic
1041652708 8:60316842-60316864 AAAGGAAAGCAGAGTAAGCTCGG - Intergenic
1043106623 8:76121427-76121449 TTGGAAATGCAAAATGAGCTGGG + Intergenic
1043111905 8:76196091-76196113 TAGTAAAAGCAGAATTAGAGAGG + Intergenic
1043704928 8:83336410-83336432 TAGGAAAAAAGGAACAAGCTGGG + Intergenic
1043769972 8:84185025-84185047 TTGGTAAAGCAAAATAGGCTGGG - Intronic
1043815789 8:84799649-84799671 AAGGAAGAGCAAAATAAGCGAGG + Intronic
1044378098 8:91500002-91500024 TGGGAAAAGCATAATTATCTGGG + Intergenic
1044858996 8:96503567-96503589 TAGGAAAATCAGAATAAGATTGG + Intronic
1046543567 8:115618538-115618560 TAGGGACAGCAGAATGACCTTGG - Intronic
1046879396 8:119291545-119291567 TAGGGAAGACAAAATAAGCTAGG - Intergenic
1047625815 8:126655018-126655040 TATGAAAAGCAGAAAGTGCTGGG + Intergenic
1050039016 9:1468725-1468747 TATGAAAAGAAGAAAAGGCTAGG + Intergenic
1053074113 9:35118241-35118263 TAAGAAAATCAGAATAGGCCGGG - Intergenic
1053673062 9:40389148-40389170 TAAGAAAATGAGAATAAGCCGGG - Intergenic
1053676367 9:40433997-40434019 TAAGGAAACCAGAATATGCTGGG + Intergenic
1053926142 9:43060113-43060135 TAAGGAAACCAGAATATGCTGGG + Intergenic
1054289435 9:63269522-63269544 TAAGGAAACCAGAATATGCTGGG + Intergenic
1054384168 9:64529214-64529236 TAAGAAAATGAGAATAAGCCGGG - Intergenic
1054387467 9:64574068-64574090 TAAGGAAACCAGAATATGCTGGG + Intergenic
1054508255 9:65942297-65942319 TAAGGAAACCAGAATATGCTGGG - Intergenic
1054511563 9:65987135-65987157 TAAGAAAATGAGAATAAGCCGGG + Intergenic
1055406754 9:75982612-75982634 CAGGAAAAGCAGCAAAAGATAGG - Intronic
1057392321 9:94650062-94650084 TAAGAAAAGCCGCATACGCTGGG - Intergenic
1057617999 9:96609911-96609933 TCTGAAAAGCTGAAGAAGCTAGG - Intronic
1058456183 9:105140256-105140278 TAGGAAAACCAGAATGAATTAGG - Intergenic
1058650323 9:107169832-107169854 CAGGATAACCAGAATAACCTTGG + Intergenic
1059487400 9:114637246-114637268 TAGGAAATGTAGAAGAAGCGAGG - Intronic
1060710322 9:125857023-125857045 AAGATAAAGCTGAATAAGCTAGG - Intronic
1061473179 9:130843709-130843731 CAGGAAGAGCAGAAGAGGCTGGG + Intronic
1061567164 9:131448713-131448735 TAAGAATGGCAGAACAAGCTGGG - Intronic
1061731914 9:132621972-132621994 TAAGAAAAGCTGAGTAAGTTTGG - Intronic
1186312734 X:8338369-8338391 GACGAAAAGCAGAATAAGGGAGG + Intergenic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187200451 X:17129243-17129265 TGTGGAAAGCAGAATAAGGTGGG - Intronic
1188983966 X:36753148-36753170 TAGGAAAAGTAGAAAAAACTAGG - Intergenic
1189493822 X:41491770-41491792 AATGAAAAGCAGAAATAGCTGGG + Intergenic
1190176064 X:48150721-48150743 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190182074 X:48201233-48201255 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190187457 X:48248259-48248281 TTGGAAAAGAAGAATAAGGTGGG - Intronic
1190191950 X:48284424-48284446 TTGGAAAAGAAGAATAAGGTGGG - Intergenic
1190195214 X:48311949-48311971 TTGAAAAAGAAGAATAAGATGGG - Intergenic
1190201220 X:48363025-48363047 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202483 X:48375152-48375174 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202656 X:48376858-48376880 TTGAAAAAGAAGAATAAGGTAGG + Intergenic
1190207882 X:48418552-48418574 TTGAAAAAGAAGAATAAGGTAGG - Intergenic
1190208055 X:48420258-48420280 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190210686 X:48444302-48444324 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190656339 X:52616028-52616050 TTGGAAAGGAAGAATAAGGTGGG - Intergenic
1190661655 X:52660168-52660190 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190669300 X:52725742-52725764 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190670117 X:52732662-52732684 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1191015083 X:55800843-55800865 TAAGAAAAACAAAATAGGCTGGG + Intergenic
1191929913 X:66360597-66360619 TAACAAAAGCACAATAAGTTTGG - Intergenic
1192593950 X:72387089-72387111 TAGGCAGAGCACAATGAGCTAGG + Intronic
1192695517 X:73411343-73411365 TCAGAAAACCAGAACAAGCTGGG - Intergenic
1194956272 X:100184544-100184566 TAGGCAAGGCATAATAAGCAAGG - Intergenic
1195775510 X:108399809-108399831 TAGGAAAATCAGAGTAGGCTGGG - Intronic
1197013135 X:121591534-121591556 TTTGAAAATCAGAAAAAGCTAGG - Intergenic
1198941964 X:141965949-141965971 TAGCTAAAGCTGAAGAAGCTGGG - Intergenic
1199082533 X:143592677-143592699 TTTGGGAAGCAGAATAAGCTAGG + Intergenic
1200411970 Y:2869760-2869782 GAGGAAAAGCGGAATAAGAAAGG + Intronic