ID: 913358586

View in Genome Browser
Species Human (GRCh38)
Location 1:117952634-117952656
Sequence CTCTTATTCTTGAGGAAGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913358579_913358586 18 Left 913358579 1:117952593-117952615 CCATGACAAATCTCTGAGACTTT 0: 1
1: 0
2: 2
3: 18
4: 231
Right 913358586 1:117952634-117952656 CTCTTATTCTTGAGGAAGAAAGG 0: 1
1: 0
2: 2
3: 22
4: 241
913358578_913358586 19 Left 913358578 1:117952592-117952614 CCCATGACAAATCTCTGAGACTT 0: 1
1: 0
2: 1
3: 17
4: 160
Right 913358586 1:117952634-117952656 CTCTTATTCTTGAGGAAGAAAGG 0: 1
1: 0
2: 2
3: 22
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913358586 Original CRISPR CTCTTATTCTTGAGGAAGAA AGG Exonic
902768204 1:18630749-18630771 CTTTTATTCATGAGGAGGGAAGG - Intergenic
903574818 1:24332762-24332784 CCTTTATTCTTGAGGTAGAGTGG - Intronic
903871474 1:26438113-26438135 CTCATATTCTTCAGGGATAAAGG - Intronic
904292279 1:29495684-29495706 CTCTACATCTTGATGAAGAAAGG + Intergenic
904537313 1:31208448-31208470 CTCTTATTAGCAAGGAAGAAAGG - Intronic
906005765 1:42468542-42468564 ATCTTATTTCTGTGGAAGAAGGG + Intronic
906120142 1:43384231-43384253 TTCTTATTTTGGAGGGAGAAGGG - Exonic
906849003 1:49227452-49227474 ATCTTATTCTTGCAGAAGAATGG - Intronic
908156903 1:61362658-61362680 CTCTTATTATCTGGGAAGAAGGG + Intronic
909745049 1:79084819-79084841 GTCTTATTCTGGAGGGAAAAAGG - Intergenic
910602796 1:89049930-89049952 TTCTCAATCTTGAGGGAGAATGG - Intergenic
913270661 1:117090033-117090055 CCTTTTTTGTTGAGGAAGAAGGG - Exonic
913358586 1:117952634-117952656 CTCTTATTCTTGAGGAAGAAAGG + Exonic
914227045 1:145729217-145729239 CTCTTACTCTTGTAGGAGAATGG + Intronic
914675397 1:149904110-149904132 CTCTGCTTCTTGAGGAGGGAAGG + Exonic
914678927 1:149925742-149925764 CTGTTACTGTTGAGGAACAAAGG + Intronic
915848146 1:159290558-159290580 ATCTTAAACATGAGGAAGAAAGG - Intronic
916071487 1:161172638-161172660 CTCTTATTCTTTTGACAGAATGG - Intronic
916571385 1:166030899-166030921 ATCTTATTGTTGAGAAAGAAAGG + Intergenic
916841857 1:168609328-168609350 CTCTTCTTCCTAAGGAAGTAGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917578128 1:176345459-176345481 CTCATATTCTTGAGCAAAACCGG - Intergenic
918129333 1:181611551-181611573 ATCTTATCCTTGAGGAAGAATGG - Intronic
919041788 1:192398319-192398341 CTCTTAGGTTTGATGAAGAATGG + Intergenic
920422380 1:205843910-205843932 ATTTTATACTGGAGGAAGAATGG + Intronic
920434085 1:205936941-205936963 CTTTTATTAATGAGGCAGAATGG + Intronic
921287309 1:213620857-213620879 CTCTAATTCTTTAGTAAGTACGG - Intergenic
923982845 1:239345154-239345176 CTGTTATTCATGAGTAAGAATGG - Intergenic
1064571255 10:16695616-16695638 CTCTTATACTTGAGTAACAACGG - Intronic
1065831354 10:29617162-29617184 CTCTTTTCCTTTATGAAGAAAGG + Intronic
1066547162 10:36512101-36512123 CTAATATTCTAGAGGAAGAAGGG - Intergenic
1067817629 10:49494526-49494548 ATCTGATTCTTCAGGAAAAAGGG - Intronic
1068244922 10:54352446-54352468 CTTGGATTCTTGAGGAAGCATGG - Intronic
1068415911 10:56722779-56722801 TTCCTATTTTTGAAGAAGAATGG - Intergenic
1069763359 10:70831854-70831876 CCCATATTCTGGAGGAAGGAAGG - Intronic
1072269759 10:93765009-93765031 ATTTTATTCATGAGGAAGAAAGG - Intronic
1072436597 10:95419682-95419704 CTTTTAGTCCTGAAGAAGAAAGG + Intronic
1073255982 10:102151659-102151681 CTCTGATCCCGGAGGAAGAAGGG + Intergenic
1073508067 10:104019996-104020018 CTCTAATTGTTTAGAAAGAAAGG - Intronic
1073737577 10:106367445-106367467 CTCCTCTTCTTGAGTATGAATGG - Intergenic
1077765121 11:5150504-5150526 CTCTGATTCTTGAGGAATGATGG - Intergenic
1084049629 11:66591405-66591427 CTGTTTTTCTTGACGTAGAAAGG + Exonic
1085258213 11:75189179-75189201 GTCATAATCTTGAGAAAGAATGG - Intronic
1085308981 11:75505148-75505170 CTCTCACTCTTGAGGTAGATAGG + Intronic
1085662478 11:78381900-78381922 CTCTTATTCTTTAAGCAGCAAGG - Intronic
1085849928 11:80108287-80108309 TTAGTATTCTTGAGGAAGATAGG + Intergenic
1086944890 11:92835200-92835222 CTCCTATTCTTGGGGACAAATGG - Intronic
1087616851 11:100495987-100496009 CTCTTTATCTTGTGGAATAATGG - Intergenic
1088206254 11:107396478-107396500 TTCTTATTTTAAAGGAAGAAAGG + Intronic
1089544036 11:119208690-119208712 CTCTTATTCTTTAAGAATACAGG - Intronic
1090735281 11:129607458-129607480 CTTTCATTCTTGTGGAAGATGGG - Intergenic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1093783496 12:23165396-23165418 CTCTGATTCTTCATGAACAAAGG + Intergenic
1095258308 12:40067907-40067929 CTTTTTTTCTTGTTGAAGAAAGG + Intronic
1097348026 12:58516836-58516858 CTCTGATACAAGAGGAAGAAAGG + Intergenic
1097376563 12:58850125-58850147 CTCTTATTATTGAGTAACATGGG - Intergenic
1100533627 12:95484051-95484073 TTCGTAGTGTTGAGGAAGAAAGG + Intronic
1101510633 12:105389549-105389571 CTCTTATACTGGAGAAAGTACGG - Intronic
1104210149 12:126681074-126681096 CCCTCAGTCTTCAGGAAGAAGGG - Intergenic
1107215427 13:37912022-37912044 CTTGTATCCTTGAGGAATAAAGG + Intergenic
1108059287 13:46516547-46516569 CTCTTCTTTTTGATAAAGAAAGG - Intergenic
1109741772 13:66563080-66563102 CTCTGATTCCTCAGGCAGAATGG - Intronic
1110774397 13:79390872-79390894 CTCTTATTTTTGGTGATGAAAGG - Intronic
1113634581 13:111910702-111910724 CTCATTTTATAGAGGAAGAATGG + Intergenic
1113696784 13:112352317-112352339 CTCTTAGTCTTGCTCAAGAAGGG + Intergenic
1114221214 14:20699178-20699200 TACTCACTCTTGAGGAAGAAGGG + Intronic
1114587847 14:23831168-23831190 GGCTTATTCTTGAAGGAGAATGG + Intergenic
1115392434 14:32868225-32868247 CTCTTATTGTTTACAAAGAATGG - Intergenic
1115857842 14:37650184-37650206 ATCTTTTTCTTGAGGACGAAGGG + Intronic
1116315507 14:43386152-43386174 TTCTTATTCTTGAGGTTTAAGGG - Intergenic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1117581386 14:57155027-57155049 TTATTATTATTGAGGAAAAAAGG - Intergenic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1121219037 14:92272047-92272069 CTCTTCCTCTGGAGGAGGAAGGG - Intergenic
1122250090 14:100432029-100432051 CACTCATCTTTGAGGAAGAATGG - Intronic
1125581017 15:40785794-40785816 CTCTTATTCAAGGGGTAGAAGGG + Intronic
1125936822 15:43644314-43644336 AGCTTATTCTTGTGGTAGAAAGG - Intronic
1126678545 15:51182773-51182795 CTTTTGTTGGTGAGGAAGAAAGG + Intergenic
1128618869 15:69132148-69132170 CTGTTTTTCATGAAGAAGAAGGG - Intergenic
1131456337 15:92585297-92585319 CTCGTATTCTTGAGGGAGAAGGG - Intergenic
1132683105 16:1151957-1151979 CTCTTTGTCTGGAGGGAGAAGGG + Intergenic
1134280783 16:12815018-12815040 TTCTTATTCTTGTTGAAAAAGGG - Intergenic
1135009910 16:18866414-18866436 CACTAATTCTTCAGTAAGAAAGG + Intronic
1137223158 16:46475943-46475965 CTCTTTTTCTTGAAGAAGTTTGG + Intergenic
1138657853 16:58501089-58501111 CTCTCCCTCCTGAGGAAGAATGG - Intronic
1139074090 16:63422024-63422046 CTCTTCATCTAGAGGAAGCATGG - Intergenic
1140107653 16:71975462-71975484 ATCTTAGATTTGAGGAAGAAAGG - Intronic
1141390703 16:83660722-83660744 ATCTGAATCTGGAGGAAGAATGG - Intronic
1142416018 16:89942652-89942674 CTCTTATTCCTGAGTATGCATGG - Intergenic
1142951179 17:3481740-3481762 CTCTTATTCTTGAGGATTCCAGG + Exonic
1144218486 17:13078967-13078989 CTGTTTTTCAAGAGGAAGAAAGG - Intergenic
1146136493 17:30325878-30325900 CCCTTATTGTAGAGGAAAAAAGG - Intronic
1148085336 17:44990486-44990508 CTTTTCTTCTTGGGGTAGAAGGG - Intergenic
1148583103 17:48757167-48757189 CTCCTATGCTTGAGAAAGCAGGG + Intergenic
1148917954 17:50999767-50999789 CTCTTGTTCTTCAGAAAGAAAGG - Intronic
1150513102 17:65776991-65777013 ATTTTATTCTTATGGAAGAAGGG - Intronic
1153445720 18:5170677-5170699 CTCTGTTTCTTGATGAAGAATGG - Intronic
1154079782 18:11244783-11244805 ATCTTTTTCTTGAGGGAGATTGG - Intergenic
1159634437 18:70788281-70788303 TACTCATTCTTCAGGAAGAAAGG - Intergenic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1160316367 18:77851489-77851511 CTCCTATTCATGTGGAAGAAAGG - Intergenic
1162513076 19:11131506-11131528 CTCTTATCCTTCACGAGGAAAGG - Exonic
929107746 2:38380607-38380629 CTCCTTTTCTTGTGCAAGAATGG + Intergenic
930211730 2:48645969-48645991 GTGTTATTTTAGAGGAAGAAAGG + Intronic
930740528 2:54827827-54827849 CTCTGATTCTAAAGCAAGAAGGG - Intronic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
934157833 2:89219709-89219731 TTCTCTCTCTTGAGGAAGAAGGG - Intergenic
934535676 2:95131254-95131276 TTCTTATCCATGAGGAAGAGTGG - Intronic
935426270 2:102921307-102921329 TTCTTCTTCTTAATGAAGAAAGG + Intergenic
936368648 2:111884080-111884102 CCCCTATTCTGGAGGAAGAACGG + Exonic
937148093 2:119664432-119664454 CTCTTCTTGTTGAAGAAGAAGGG - Intergenic
938256597 2:129864147-129864169 ATTCCATTCTTGAGGAAGAAGGG + Intergenic
938699442 2:133863112-133863134 CTTCCAGTCTTGAGGAAGAAAGG - Intergenic
941177362 2:162215207-162215229 CTCTTCTTCGTGAAGCAGAAGGG + Intronic
943836523 2:192521129-192521151 CCCTTGTTCTAGAGTAAGAAAGG - Intergenic
944293497 2:198035164-198035186 TTCTCATTGTTGAAGAAGAAAGG + Intronic
947434446 2:230060836-230060858 CTCTGAGTCTGGAGGAAGGAGGG + Intronic
947996621 2:234533474-234533496 ATCTTTTTCTTCAGAAAGAAAGG + Intergenic
1170077474 20:12435438-12435460 CGCTTTTTCTTCAGCAAGAAGGG - Intergenic
1170860081 20:20094703-20094725 CTCTGATGCTTGAGGCAGCACGG - Intronic
1171481817 20:25460338-25460360 CTCTAAATCACGAGGAAGAAGGG + Intronic
1173855352 20:46246873-46246895 CTCTCACTCTTCAGGAAGAAAGG - Intronic
1174262821 20:49309397-49309419 TTCTTATTGTTGAGTAATAAGGG + Intergenic
1175119126 20:56704834-56704856 CTCAGTGTCTTGAGGAAGAAGGG - Intergenic
1175769800 20:61616482-61616504 CTCTTACTGTGGAGGAAAAAAGG - Intronic
1176304576 21:5116473-5116495 CTCTTAATTTTCAGGAAGAAAGG - Exonic
1179852478 21:44145557-44145579 CTCTTAATTTTCAGGAAGAAAGG + Exonic
1180242480 21:46519545-46519567 CTTTTATATTTGAGAAAGAAAGG + Intronic
1180786659 22:18551408-18551430 CCTTTATTCTGGAGGATGAAAGG + Intergenic
1181131950 22:20737221-20737243 CCTTTATTCTGGAGGATGAAAGG + Intronic
1181243574 22:21490929-21490951 CCTTTATTCTGGAGGATGAAAGG + Intergenic
1181794553 22:25295821-25295843 TTCTTATTCTTGAGCTTGAAAGG + Intergenic
1184304848 22:43590809-43590831 CTCTTTTTCTTGAGCAAAGATGG + Intronic
954007019 3:47599509-47599531 CTATTATCCCTGTGGAAGAAAGG + Intronic
954395557 3:50291613-50291635 TTTTTATTCTTGAGGGGGAAGGG - Intronic
955159734 3:56452955-56452977 ATTTTACTCATGAGGAAGAAAGG - Intronic
955441039 3:58955795-58955817 TTCTTCTGCTTGAGGAAGACTGG + Intronic
956506406 3:69944821-69944843 CTCTTATTCTTGATGAACTTGGG + Intronic
959739720 3:109703438-109703460 CTCTTACTCCTGAGGATCAATGG - Intergenic
960394434 3:117118958-117118980 CTCTGATTTTTGAGGAAAAAGGG + Intronic
963101990 3:141616569-141616591 TTCTTATTCTTGTGTAATAAAGG - Intergenic
963104444 3:141634695-141634717 CTCTTATTTTTTTTGAAGAATGG - Intergenic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964545793 3:157831647-157831669 CTCTTATTTTTGAGGTACTAAGG - Intergenic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
965480049 3:169207123-169207145 CTTTCATCATTGAGGAAGAAAGG + Intronic
967335288 3:188337315-188337337 CTCTTTTTCTTGGGGAAGCACGG + Intronic
967563790 3:190949898-190949920 CTCTTAATCTTGATGAAACAAGG - Intergenic
974529206 4:63085280-63085302 CTGACATTCCTGAGGAAGAAGGG - Intergenic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
975788438 4:77920694-77920716 TTCTTCTTCTAAAGGAAGAAGGG + Intronic
976962973 4:91002365-91002387 CTGGTATTCCTGAGGAAGAAGGG - Intronic
977329867 4:95624028-95624050 CCCTTCATCTTGAGGAAGAGTGG - Intergenic
979585582 4:122411896-122411918 CTCATAAACTTGAGGAAGTATGG + Intronic
979653268 4:123161423-123161445 CACTAAGTCTTGGGGAAGAAAGG + Intronic
979985333 4:127306832-127306854 AAATTATTCTTGGGGAAGAAAGG - Intergenic
981041860 4:140230521-140230543 CTATTAGGCTTGGGGAAGAAGGG - Intergenic
981690332 4:147500828-147500850 TTCATATATTTGAGGAAGAAAGG + Intronic
981798514 4:148628363-148628385 GTCTTATTCATCAGGAAAAATGG + Intergenic
983394242 4:167173137-167173159 CTTTCATTCTTCAGGATGAAAGG + Intronic
986040005 5:3984232-3984254 AGCTTAAGCTTGAGGAAGAAGGG - Intergenic
987191369 5:15481776-15481798 TTATTATCCTTGAGGAAGACAGG - Intergenic
987699251 5:21375049-21375071 CTCTTTTTCATGGGGAAGAGTGG + Intergenic
988054071 5:26069883-26069905 CTATTATTCTAGAAGAATAATGG - Intergenic
988753170 5:34213015-34213037 CTCTTTTTCGTGGGGAAGAGTGG - Intergenic
989631743 5:43490911-43490933 ATTTTATTCTTGATGAATAATGG - Intronic
990375026 5:55161192-55161214 ATCTTAATCTTGTGGAAGATGGG - Exonic
991328427 5:65464050-65464072 CTCTTATTTTTAAGGAATGAGGG - Intronic
991740950 5:69673826-69673848 CTCTTGTTCGTGGGGAAGAGTGG - Intergenic
991756667 5:69880622-69880644 CTCTTGTTCGTGGGGAAGAGTGG + Intergenic
991792524 5:70253567-70253589 CTCTTGTTCGTGGGGAAGAGTGG - Intergenic
991820410 5:70549935-70549957 CTCTTGTTCGTGGGGAAGAGTGG - Intergenic
991836070 5:70756504-70756526 CTCTTGTTCGTGGGGAAGAGTGG + Intergenic
991884974 5:71253894-71253916 CTCTTGTTCGTGGGGAAGAGTGG - Intergenic
992796223 5:80256721-80256743 CTCTTTTTAGTGAGGAAGCAGGG - Intergenic
994058561 5:95447621-95447643 CACTTATTCCTGAGGCAGATGGG + Intronic
994128719 5:96199229-96199251 ATTTTATTTTTGAGAAAGAAAGG + Intergenic
994413347 5:99437677-99437699 CTCTCATCCTCGAGAAAGAAAGG + Intergenic
995068915 5:107895248-107895270 CTTGTATGCTTGAGGAAGACTGG + Intronic
996494949 5:124144233-124144255 CTCTTATTCATGAGGGATATTGG - Intergenic
996811769 5:127523686-127523708 CTATTATTTTTCAGGATGAAAGG + Intronic
996924994 5:128814401-128814423 CTCTGACTTTTGAGGAAGTATGG - Intronic
998842712 5:146272824-146272846 CCCTGATTCTTGGGGAAGATAGG + Intronic
999929234 5:156412533-156412555 CTTTTACTCATGAGGAAAAAGGG + Intronic
1000630651 5:163587000-163587022 CTCTTTTTCCTCATGAAGAAGGG + Intergenic
1005152930 6:22773136-22773158 CTCTTTCTCTTTAGGTAGAAGGG + Intergenic
1005655442 6:27930685-27930707 TTCTTATTCTTTATGAAAAATGG + Intergenic
1005894310 6:30164494-30164516 CTCTTCTTCTTGAGAAAGGGAGG + Intronic
1005976654 6:30805248-30805270 CCCATATCCTGGAGGAAGAAAGG - Intergenic
1011261384 6:85473501-85473523 CCATTATTCTAAAGGAAGAAGGG - Intronic
1013761168 6:113520286-113520308 CTTTTATTTTTGAGTAGGAAGGG - Intergenic
1016899587 6:149088503-149088525 CAGTTCTTCTTGAGCAAGAAAGG - Intergenic
1017023255 6:150158823-150158845 ATCTTCTTTTTGAGGAAGATGGG + Intronic
1017117685 6:150994405-150994427 CTCTTCTTCTTGAAATAGAAAGG + Intronic
1017198186 6:151724335-151724357 CTGTCAGTCTTGAGGAAGGAGGG - Intronic
1018576577 6:165266155-165266177 CATTTATTTTTGAGGAAGGATGG + Intergenic
1020150289 7:5676695-5676717 CCCCTATTCTTAAGGAATAATGG + Intronic
1020700752 7:11479499-11479521 CACTAATTCTTGAAGAATAATGG + Intronic
1022839761 7:34152278-34152300 TTCCTATTCTTGAGGAATGAGGG + Intronic
1024301774 7:47892464-47892486 CTTTTACTCTTGAGTAAAAAGGG + Intronic
1024416476 7:49113640-49113662 GACTTATTAGTGAGGAAGAAAGG + Intergenic
1024933398 7:54688133-54688155 TTCTTATTTTAGAGGAAGACTGG + Intergenic
1026595004 7:71727073-71727095 TTCTTATTTTTGAGGCAGAGTGG - Intergenic
1027378911 7:77584086-77584108 CTCTTGTTCTTTTGGATGAAGGG + Intronic
1027730607 7:81867407-81867429 TTCTTATGCTTGTGGCAGAAAGG - Intergenic
1028112687 7:86961656-86961678 CATTTATTCTTGAAGAACAATGG - Intronic
1028181542 7:87730467-87730489 CTCTTCTGCTTGAGGAAAAGGGG + Intronic
1028318069 7:89428788-89428810 GTCTTCTGCTTGGGGAAGAAAGG + Intergenic
1028425984 7:90689421-90689443 CTCTTAAGATTGAGCAAGAATGG + Intronic
1028488659 7:91386972-91386994 CTTACATTTTTGAGGAAGAAAGG - Intergenic
1028912150 7:96220585-96220607 CTCTTATACCAGAAGAAGAATGG + Intronic
1030244159 7:107362565-107362587 CTTTTATGCTTAAGAAAGAAAGG + Intronic
1031093848 7:117394924-117394946 CTTTTATTGTTCAGGAATAAAGG + Intronic
1031154185 7:118089351-118089373 CTCTTATTCTCCATGAAGCAGGG - Intergenic
1031674553 7:124592914-124592936 CTCTTATCCTCCAGGAAGAGGGG + Intergenic
1032650714 7:133875265-133875287 CTCTGAGTTCTGAGGAAGAAGGG + Intronic
1032737185 7:134703250-134703272 TTGTTATTATTGAGGAAGACAGG + Intergenic
1034145285 7:148865600-148865622 TTCTCATTCTAGAGGAAAAATGG + Intronic
1034590871 7:152137914-152137936 TCCTTATTCTTGACTAAGAAAGG + Intronic
1034646146 7:152649712-152649734 GTTTTATACTTTAGGAAGAAGGG - Intronic
1035113510 7:156504574-156504596 CTCTGCTCTTTGAGGAAGAAAGG + Intergenic
1035191063 7:157169034-157169056 CTTTTATTGTTTAGGAAGAAAGG + Exonic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1040653950 8:49482541-49482563 CACTGCTTCTTGATGAAGAATGG - Intergenic
1041816394 8:61976771-61976793 CCCTTAATTTTAAGGAAGAAAGG + Intergenic
1042810068 8:72815181-72815203 CTTTTAATATTAAGGAAGAAAGG + Intronic
1043373536 8:79621531-79621553 CTCTTCTTTAGGAGGAAGAAGGG - Intronic
1043745895 8:83872898-83872920 CTCTTCTTCTTGTGGAAGTTTGG + Intergenic
1045058608 8:98392361-98392383 CCCATATTAGTGAGGAAGAAAGG + Intergenic
1046253388 8:111664318-111664340 TTCTTATTCCTGAGACAGAAAGG - Intergenic
1046304490 8:112346415-112346437 CACTTATTTCTGAGGAAGGAAGG - Intronic
1047182975 8:122606648-122606670 CTTTCATTCTTGATGTAGAAAGG + Intergenic
1047462523 8:125080759-125080781 CTGTGATTCTTCAGGAAGTAAGG - Intronic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1050587673 9:7129984-7130006 CTCTTAACCCTGGGGAAGAAAGG + Intergenic
1050770784 9:9197114-9197136 ATCTTATTCAGAAGGAAGAAAGG - Intronic
1051747832 9:20311940-20311962 ATCTGATTGTTGAGAAAGAATGG + Intergenic
1052457983 9:28725458-28725480 CTTTTATTCGTGAATAAGAACGG - Intergenic
1053409966 9:37909557-37909579 CTCTTGTCCTTGGGGCAGAAGGG + Intronic
1053491777 9:38512175-38512197 CTCTTGTTCTTGAAGAATATTGG - Intergenic
1054858735 9:69928293-69928315 CTATTCTTCTTGAGGAAGGTGGG + Intergenic
1055301061 9:74883450-74883472 CTTTTATTTTTGAGATAGAAAGG - Intronic
1055995601 9:82155772-82155794 TTCTTATTCTCGGGGGAGAAAGG + Intergenic
1056316735 9:85397548-85397570 CTCTTTTTCTTGAGGGGAAAGGG - Intergenic
1056474331 9:86938983-86939005 CTTTGATCCTAGAGGAAGAAAGG - Intergenic
1057672074 9:97101377-97101399 CTCTTGTTCTTGAAGAATATTGG - Intergenic
1059111767 9:111564641-111564663 TTCTTATTCTTGAAGAAGCAAGG + Intronic
1059268535 9:113058358-113058380 TTCTGATTTGTGAGGAAGAAAGG - Intergenic
1186296050 X:8149608-8149630 CTCTCATCCTTGAGAAATAAAGG + Intergenic
1186330478 X:8527040-8527062 CTCTGATCTTTGATGAAGAATGG + Intergenic
1187674061 X:21698257-21698279 GATTTATTATTGAGGAAGAAGGG + Intergenic
1189079197 X:37951892-37951914 ATCATATTCTTGAGGAGGATGGG + Intronic
1189178123 X:38978532-38978554 CCCTAATTCTGGGGGAAGAAGGG - Intergenic
1189223318 X:39391605-39391627 CTCTTACTCTTCAGGTAGAATGG - Intergenic
1192915635 X:75648582-75648604 GTTTTTTTCTTGAGGAAGCATGG - Intergenic
1193670500 X:84378702-84378724 CACTTTCTCTAGAGGAAGAAAGG + Intronic
1195100155 X:101547848-101547870 ATCTTATTCTTGAAGAAAATGGG - Intergenic
1195619942 X:106942902-106942924 TTCTAATTCTTCAGGAAGCAGGG + Exonic
1195657015 X:107341428-107341450 ATTTTATTATTGTGGAAGAAGGG + Intergenic
1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG + Intergenic
1198020375 X:132651494-132651516 CTCTTAGGCATGAGTAAGAAAGG + Intronic
1199182701 X:144877650-144877672 CTCTTATTAGTAAAGAAGAAAGG + Intergenic
1199495262 X:148445802-148445824 CTCCTATTCATGAGTTAGAAAGG - Intergenic
1200404208 Y:2792611-2792633 CTCTTTGTTTTAAGGAAGAAAGG - Intergenic
1201432748 Y:13921839-13921861 CTCTGATCTTTGATGAAGAATGG - Intergenic