ID: 913361917

View in Genome Browser
Species Human (GRCh38)
Location 1:117990043-117990065
Sequence AAGGGTGACCACAGAGTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913361907_913361917 7 Left 913361907 1:117990013-117990035 CCACCCTACTACAGGAGTTGCCC No data
Right 913361917 1:117990043-117990065 AAGGGTGACCACAGAGTATAGGG 0: 1
1: 0
2: 0
3: 12
4: 134
913361910_913361917 3 Left 913361910 1:117990017-117990039 CCTACTACAGGAGTTGCCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 104
Right 913361917 1:117990043-117990065 AAGGGTGACCACAGAGTATAGGG 0: 1
1: 0
2: 0
3: 12
4: 134
913361908_913361917 4 Left 913361908 1:117990016-117990038 CCCTACTACAGGAGTTGCCCAGG 0: 1
1: 0
2: 2
3: 8
4: 90
Right 913361917 1:117990043-117990065 AAGGGTGACCACAGAGTATAGGG 0: 1
1: 0
2: 0
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913361917 Original CRISPR AAGGGTGACCACAGAGTATA GGG Intronic
908801472 1:67885034-67885056 GAGGGTGCCCACAGAGGAGATGG + Intergenic
912190876 1:107338763-107338785 GAGAATGACCACAGAGAATAGGG + Intronic
913361917 1:117990043-117990065 AAGGGTGACCACAGAGTATAGGG + Intronic
914222022 1:145689751-145689773 ACGGATGACCACACAGGATATGG + Intronic
916155005 1:161836094-161836116 AAAGGTAACCACGGAGCATATGG + Intronic
918105973 1:181415511-181415533 GAGGGTAACCAGAGGGTATAGGG + Intronic
919016330 1:192042422-192042444 AATGGGGACCACAGCGTATAGGG + Intergenic
919145040 1:193623360-193623382 AAGACTGTCCACAGAGTTTATGG + Intergenic
919237337 1:194862276-194862298 AAGTGAGAACACAGTGTATATGG + Intergenic
920654235 1:207863779-207863801 TAGGGTGACCCCATACTATATGG - Intergenic
920773072 1:208908464-208908486 AAGAGTGAAGACAGAATATAAGG - Intergenic
920923448 1:210318803-210318825 AAGGGTAACCACAATATATAAGG - Intergenic
921276435 1:213525308-213525330 AAGGGTGACCCCAAAGTGCAAGG + Intergenic
922372129 1:224922251-224922273 AAGGGTAACTATAGAATATAAGG + Intronic
922865385 1:228856430-228856452 AATAGTGACCAAAGAGAATAGGG - Intergenic
1062990685 10:1812483-1812505 AAGGCTGACCCCAAAGTTTAAGG - Intergenic
1066045100 10:31587928-31587950 AAGGCTCACCACAGAGGTTAAGG - Intergenic
1067443576 10:46326856-46326878 AAGAGCGACCAGAGAGTCTATGG - Intronic
1068200427 10:53776797-53776819 AAGGGAGAACACATGGTATATGG - Intergenic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1071960218 10:90802936-90802958 AACTGAGACCATAGAGTATATGG + Intronic
1074960694 10:118442677-118442699 AATGGTGACCTCAAAGTAGAGGG + Intergenic
1075262641 10:120976481-120976503 AAGTGTGACCTCGGACTATAGGG + Intergenic
1076397041 10:130146978-130147000 AAGGGTGACAACAGAGGAACGGG - Intronic
1076486146 10:130819023-130819045 AAGGGAGAACACACAGTATGTGG + Intergenic
1077729866 11:4718838-4718860 AATGGTGACCAGAGTGGATATGG - Intronic
1078822387 11:14894950-14894972 ATGGGTGAACACACTGTATAGGG + Intergenic
1085865683 11:80289087-80289109 AAGGCATGCCACAGAGTATAAGG - Intergenic
1086657637 11:89379698-89379720 AAGGCTGACCCCAGAGTTTTTGG - Intronic
1091336143 11:134767677-134767699 AAAGGAGACAACAGAGTATAGGG + Intergenic
1093209004 12:16285028-16285050 AAGCGAGAACACACAGTATATGG + Intergenic
1096447627 12:51708024-51708046 AAAGGTGATCACATAGTCTAGGG - Intronic
1098382951 12:69888164-69888186 TATGGAGAACACAGAGTATATGG + Intronic
1099837575 12:87926695-87926717 AAAGAAAACCACAGAGTATAAGG + Intergenic
1101984439 12:109434524-109434546 AAGAGTGACGACAAAGAATATGG - Intronic
1106215711 13:27697113-27697135 AAGGCTGACCAAAGATTATCTGG - Intergenic
1109994484 13:70106616-70106638 AAGAGTGAACACAAAGTAAAAGG + Intronic
1114141836 14:19920992-19921014 CATGATGACCACATAGTATAAGG - Exonic
1116591094 14:46773951-46773973 AAGGGGGACCCCAGAGCAAAGGG + Intergenic
1118263015 14:64265795-64265817 AAGGGTGATAACAGACTACATGG + Intronic
1118354919 14:65005392-65005414 AATGGTGACCACACAGTTTTAGG - Intronic
1118820330 14:69341421-69341443 CAGGGTGAGCACAGACCATACGG - Intronic
1118931345 14:70244179-70244201 AGGGGTGACCACAAAGTAATGGG + Intergenic
1127368145 15:58310414-58310436 CAGGGTGACACCAGAGTAAAAGG + Intronic
1127585110 15:60370971-60370993 TAGGGTGACCCCACAGAATATGG + Intronic
1129544821 15:76384691-76384713 AAGAGAGCCCACAGAATATATGG + Intronic
1131618603 15:94043008-94043030 AAGGGTAACTACTGAGTTTATGG + Intergenic
1132736718 16:1389688-1389710 AGGGGTGACCCCAGAGGACACGG + Intronic
1135513741 16:23112031-23112053 AAGGGATATCACAGAGAATATGG + Intronic
1137634520 16:49974167-49974189 GAGGGAGGCCACAGAGAATATGG - Intergenic
1138664062 16:58548353-58548375 AAGAGGTACCACAGAGTAGATGG - Intronic
1140392987 16:74604352-74604374 AAGGGTGTGCACAGATGATATGG + Intronic
1150558583 17:66275791-66275813 TAGAGTGACCACAGTGTATCAGG + Intergenic
1150972030 17:70039641-70039663 AAGGATGTCCACAGAGTCAATGG - Intergenic
1153375397 18:4371558-4371580 AAGGGTGACCAAAAAGCTTAGGG - Intronic
1156481905 18:37441630-37441652 GAGGGTGACCACAAAGCAGATGG - Intronic
1159927290 18:74280913-74280935 AAGGGTTTAAACAGAGTATACGG + Intronic
1160023574 18:75200665-75200687 AAGGGAAACCACAGAGATTAGGG - Exonic
1164296854 19:23918198-23918220 AAGGGGGAACACAGAGAGTAAGG + Intronic
926872895 2:17442127-17442149 AATGGTGACCACATACTATGAGG - Intergenic
928876563 2:36046990-36047012 AAGTATGTCCACAGAGTATTTGG - Intergenic
929080843 2:38120683-38120705 AAGGGGTACCACAGAGAATAGGG + Intergenic
932487059 2:72090627-72090649 CAGGGTGACCTCAGAAGATAGGG + Intergenic
933060157 2:77726735-77726757 AAGGGTAATGACAGAGAATAGGG - Intergenic
933398144 2:81757542-81757564 AAGGTAGACCATAGGGTATAGGG + Intergenic
941127263 2:161599276-161599298 AAGTGTGAACACACAGTATTTGG - Intronic
941775182 2:169385761-169385783 TTGGGTGACCACAGAGAACAGGG + Intergenic
942321556 2:174740931-174740953 AAGAGTGAGCATGGAGTATAAGG - Intergenic
942555658 2:177170140-177170162 AAGGCTGACCGCTGAGTATATGG + Intergenic
943568298 2:189542703-189542725 AAGGATGACCACTGAGGTTAGGG - Intergenic
944166692 2:196729873-196729895 AAAGGTAAACACAGAGTATATGG - Intronic
945852446 2:215025459-215025481 AATGGTGACAAAAGAGTTTATGG - Intronic
948090733 2:235292691-235292713 AAGGGGGACCAAAGAGGACAGGG - Intergenic
1169017300 20:2302347-2302369 AAGAGGGACCACAGAATAAATGG + Intronic
1169450448 20:5706330-5706352 AAGGCAGACCACAGAGGAGAGGG - Intergenic
1170948883 20:20916236-20916258 AAGGGTGACATCAGAGAAAATGG + Intergenic
1172224836 20:33298467-33298489 AAGGGCGACCAGAGAGGAGAAGG + Intronic
1175988645 20:62776819-62776841 AAGGGGGTCCACAGTGGATATGG + Intergenic
1176040157 20:63060944-63060966 AGGGGTGACCACAGTGGTTAGGG + Intergenic
1176968435 21:15237914-15237936 AAGGGTGACCCTAGAGAAGAGGG + Intergenic
1178360813 21:31947456-31947478 AAGGGTGAGGACAGAGTACGGGG - Intronic
952431199 3:33224886-33224908 ATGGGTTACCACATAGTAAATGG + Intergenic
953188154 3:40657524-40657546 AATGATGAACACAGAGTCTAGGG - Intergenic
953416646 3:42724297-42724319 AAGGGTGACCCCCGGGTATCTGG - Intronic
956019727 3:64921390-64921412 AGGGCTGACCTCAGAGTGTAAGG - Intergenic
957040158 3:75330098-75330120 AAGGGTGACCACAGAATGAGAGG - Intergenic
957509848 3:81173482-81173504 CAGGGTGACCACAAAGTATCTGG + Intergenic
959181354 3:102984745-102984767 AAGTGAGAACATAGAGTATATGG - Intergenic
960323521 3:116266486-116266508 ACAGGAGACCACAGAGAATATGG + Intronic
961044954 3:123701664-123701686 AAGGGTGACCACACAGTGAGAGG - Intronic
961103035 3:124218069-124218091 ATGGCTGACCACAGAGTTTAGGG - Intronic
962258478 3:133887764-133887786 AAGGGTTACCCCAGAGTAGGTGG + Intronic
963485188 3:145927009-145927031 AAGGGAGACCTGAGAGTAGATGG + Intergenic
963908022 3:150790030-150790052 AAGGATGAACACAGAGGATCTGG - Intergenic
966638071 3:182157627-182157649 ATGGGTGACCAAAAAGTATAGGG - Intergenic
966954007 3:184854485-184854507 AGGTGTGACCACAGAGTACCAGG - Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
969877957 4:10149884-10149906 AAGGTGGACCACAGAGTCTGGGG + Intergenic
970395068 4:15656440-15656462 AAGGGTGAACACAGCATATCTGG - Intronic
972241575 4:37198892-37198914 AAGGGAGAACACATAGTATTTGG + Intergenic
973680199 4:53309474-53309496 AAGTGTGACCACAGAGGATTAGG + Intronic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
976479663 4:85525890-85525912 AAGGGTGAGAACAAAGTAAAAGG - Intronic
977736935 4:100428002-100428024 CAGGGTGATCACAGAGTAGATGG - Intronic
978003596 4:103588713-103588735 AAGTGTGACAAAAGACTATATGG - Exonic
979881310 4:125963308-125963330 AAGGGTGATGACAGGGTATCTGG + Intergenic
983406403 4:167336260-167336282 AAGGGAGACCAGTGAGTAGAAGG - Intergenic
985065614 4:186117963-186117985 AAGGGGGACCACAGAAGATGCGG + Intronic
987112432 5:14700580-14700602 GAGGGTGAGCACAGAGGGTATGG - Intergenic
997392877 5:133531339-133531361 CAAGGTGACCACAGAGATTAGGG - Intronic
998958262 5:147458852-147458874 CAGGGAGAACACAGTGTATAGGG + Intronic
1010722809 6:79302910-79302932 AAGGGTGACCCCTGAGCATCAGG + Intergenic
1011026062 6:82870817-82870839 AATGGTGTCTACAGAGTATTGGG + Intergenic
1012870679 6:104669802-104669824 AAGGGAGAACACATGGTATAAGG - Intergenic
1013542797 6:111127786-111127808 AAGGGTGGAAACAGAGTAGAGGG + Intronic
1014513232 6:122350602-122350624 AAGGTAGACCAGAGAGTTTAAGG - Intergenic
1015588382 6:134799499-134799521 AAGGGTGAACACAGGGTCCAGGG + Intergenic
1015675148 6:135737627-135737649 AAGGGAGAACACAGAGAATGGGG + Intergenic
1018454010 6:163936005-163936027 AAGGGGGACATCAGGGTATATGG + Intergenic
1023170500 7:37386343-37386365 TAGGGAGACCACAGAGAAAAGGG + Intronic
1026235375 7:68522188-68522210 AATAGTGGCCACAGAGGATAGGG + Intergenic
1026766073 7:73160680-73160702 CAGGGTTACCACAGAGGACAAGG - Intergenic
1027042548 7:74970376-74970398 CAGGGTTACCACAGAGGACAAGG - Intronic
1027081095 7:75231981-75232003 CAGGGTTACCACAGAGGACAAGG + Intergenic
1028361323 7:89970092-89970114 ATGGGGGACCACGGAGTCTAGGG - Intergenic
1030084015 7:105802090-105802112 GAGGATGACCACAGAGCACAAGG - Intronic
1030108699 7:106008461-106008483 GAAGGTGCTCACAGAGTATATGG - Intronic
1036243874 8:7100694-7100716 AAGGCTGACCCCAGAATACAGGG - Intergenic
1037946621 8:22993577-22993599 AAGGGAGACCAGAGAGATTAAGG + Intronic
1039963331 8:42266267-42266289 AAGGCAGACCACAGAGGATGGGG - Intergenic
1041718104 8:60950446-60950468 CAGGGTGGCCACACAGTACAGGG + Intergenic
1044133170 8:88551697-88551719 AGGGATGATCACAGAGTCTAGGG + Intergenic
1044848516 8:96405528-96405550 AATGATGTTCACAGAGTATAAGG + Intergenic
1044970829 8:97617929-97617951 AATGGTGACCTCAGAGGGTAGGG - Intergenic
1051073564 9:13203216-13203238 AAGGATGAACACAGACTACAGGG + Intronic
1190683613 X:52851239-52851261 AAGAGCGACCTCAGAGTACACGG + Intergenic
1192083826 X:68074212-68074234 AAGGGTCAACACAGACTACATGG + Intronic
1194087275 X:89544074-89544096 AAGATGGACCACAGAGTAAAAGG - Intergenic
1194641327 X:96406944-96406966 ATGGGGGACCACAGGGTAGAGGG - Intergenic
1196969493 X:121093291-121093313 AAGGGTGAACACTCTGTATAAGG + Intergenic
1197993447 X:132344382-132344404 CAGGGTCACCACAGAATAAAAGG + Intergenic
1199674700 X:150178012-150178034 AAGGGGGAGCACAGAATATACGG - Intergenic
1199722698 X:150553575-150553597 TAGGGTGACCACAGAACACATGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200289443 X:154857808-154857830 AAGGGTGACCTCAGCAGATAAGG + Intronic
1200439923 Y:3199947-3199969 AAGATGGACCACAGAGTAAAAGG - Intergenic