ID: 913364256

View in Genome Browser
Species Human (GRCh38)
Location 1:118018188-118018210
Sequence CAGAACCTGCACAATCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913364256 Original CRISPR CAGAACCTGCACAATCTGGA TGG Intronic
900484898 1:2917853-2917875 CAGAGCCTGCAGAAGCTGGAAGG - Intergenic
902800551 1:18826938-18826960 CACAACCTGCACAATTCTGAAGG - Intergenic
904694196 1:32318752-32318774 CAGAACCTGCACACTCCTCAGGG - Intronic
906948420 1:50315398-50315420 AGGCACTTGCACAATCTGGAGGG - Intergenic
911233882 1:95388845-95388867 CAGAACTTGCTCAAGGTGGAGGG - Intergenic
912697633 1:111853423-111853445 TAGAACCAGAACAATCTGGGGGG + Intronic
913060106 1:115196906-115196928 AAGAAGCAGCACAATCGGGAAGG - Intergenic
913364256 1:118018188-118018210 CAGAACCTGCACAATCTGGATGG + Intronic
914806873 1:150998191-150998213 GAGAGCCTGCACAATGTGGATGG - Exonic
916259287 1:162824759-162824781 CAGAATGTGCATTATCTGGATGG - Intronic
916979372 1:170116619-170116641 CAGTTCCTCCACAATCTGAATGG + Intergenic
917535666 1:175872777-175872799 CACAGTCTGCACATTCTGGATGG + Intergenic
918207175 1:182319881-182319903 GAGAACCTGTAGAACCTGGATGG + Intergenic
920361941 1:205424762-205424784 CAGATCCTTCACAAATTGGAGGG - Intronic
921360251 1:214325147-214325169 CAGAAACAGCACAATTTGGAGGG + Intronic
922452873 1:225750869-225750891 CAAAGCCTGTACAATCAGGAGGG + Intergenic
923201494 1:231717027-231717049 CAGAGCTTGCTAAATCTGGAAGG - Intronic
1063285882 10:4687688-4687710 CAGGACCTGCTGAATCTTGAAGG + Intergenic
1068689765 10:59903939-59903961 CAAAACCTGCAAAATCTTGAAGG + Intronic
1069159375 10:65073571-65073593 CAGAACCTGCAGTATCTGTCAGG + Intergenic
1070175014 10:73962795-73962817 CAGCACCAGCACCATCTGGAGGG + Intergenic
1072372066 10:94773816-94773838 CAAAACTTCCACAATATGGAAGG + Intronic
1076437570 10:130456648-130456670 CAGCACCTGCACCATCAAGAGGG + Intergenic
1081361927 11:42190556-42190578 CAGCACCAGCACACTCTGGAAGG - Intergenic
1081410740 11:42755226-42755248 CAGAACCGGCAATATCTGCAAGG + Intergenic
1081766618 11:45615714-45615736 AAGAAACTGCCCACTCTGGATGG + Intergenic
1081966174 11:47171477-47171499 AAGAAGCTACAGAATCTGGAAGG - Exonic
1082836133 11:57651571-57651593 CAGACCCACCTCAATCTGGATGG + Intronic
1084696059 11:70756237-70756259 CAGAGCCTGGACATTCAGGAAGG - Intronic
1086911980 11:92483194-92483216 CAGGCCCTGGGCAATCTGGAAGG + Intronic
1093575356 12:20721620-20721642 CTGAACCTGCAAAATCTCCAAGG + Intronic
1097253834 12:57656710-57656732 CAAAGCCTCCACAGTCTGGAAGG - Intergenic
1097710497 12:62912419-62912441 CAGGGCTTCCACAATCTGGAGGG + Intronic
1098235730 12:68416494-68416516 CAGGCCCCGCACAAGCTGGATGG + Intergenic
1102420938 12:112802503-112802525 CAGACCCAGCACAACTTGGATGG - Intronic
1104275607 12:127324383-127324405 CAGAAACTGCTCAAGATGGAAGG - Intergenic
1104942361 12:132400987-132401009 CAGAAGCTGCATCACCTGGAAGG + Intergenic
1106717033 13:32401225-32401247 CATAACCAGCTCAATATGGATGG - Exonic
1109884499 13:68524716-68524738 CAGAGCTTCCACAATGTGGAAGG - Intergenic
1110561496 13:76914940-76914962 CAGAACCTCTACAAGCTAGAAGG + Intergenic
1111636005 13:90904528-90904550 CAGAATATGCTCAATCTGAAAGG + Intergenic
1112203310 13:97299994-97300016 CAGAACTACCACAATATGGAAGG - Intronic
1112957125 13:105073586-105073608 CAGGACCTGCAGAATCCGCATGG - Intergenic
1117444203 14:55788179-55788201 CAGAACCTGCTCCTTCTGAAGGG + Intergenic
1120302509 14:82726098-82726120 CAGAACCTGCACTTTCCTGATGG + Intergenic
1120400183 14:84021602-84021624 CAGAAACTCCACAAGCTAGAAGG - Intergenic
1124973325 15:34511831-34511853 CAAAAACTGCACATTCTGGCAGG - Intergenic
1125358494 15:38841274-38841296 CAGATCCTTCACAATCCAGATGG + Intergenic
1125480809 15:40078699-40078721 CATCACCTGCACACTATGGAAGG - Intergenic
1125612519 15:40981298-40981320 CAGAACCTGCACTGTGTAGAGGG - Intronic
1126351842 15:47752072-47752094 CAGAACCTGAAAAACCTTGAAGG + Intronic
1127717672 15:61665471-61665493 CAGAGACTGCAGAATCTGAATGG + Intergenic
1128654060 15:69446319-69446341 CAGACTCTGCACCATCTGGTTGG - Exonic
1129470261 15:75749914-75749936 CAGGGCCTGCTCTATCTGGAAGG - Intergenic
1131261815 15:90891551-90891573 CAGAACCTGTACCGACTGGAAGG + Exonic
1132209406 15:100008817-100008839 CAAAAACGGCACAAACTGGAGGG - Intronic
1132794001 16:1709559-1709581 CAGAAACTGCACTGTCTGGTAGG - Intronic
1133741244 16:8653120-8653142 AAGAAACAGCACAGTCTGGAAGG - Intergenic
1137575096 16:49594172-49594194 AACACCCTGCACAATCTGGAAGG - Intronic
1143190048 17:5034228-5034250 CAGCACCTGTACCACCTGGATGG + Exonic
1144421280 17:15101426-15101448 CAGAACAAACACAACCTGGAAGG - Intergenic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1146927086 17:36752695-36752717 CTGAGCCTGCAAAATCTGGAAGG + Intergenic
1147034800 17:37671867-37671889 CAGCACCTGCACTGGCTGGAGGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1156454104 18:37283178-37283200 CAGACCCTGAAGTATCTGGAAGG - Intronic
1157868569 18:51208409-51208431 CAGAACCTACACATTCTATAAGG + Intronic
1161530503 19:4786315-4786337 CAACATCTGCACACTCTGGAGGG + Intergenic
1161817147 19:6506368-6506390 CAGCTCCAGCACAATCTTGAAGG + Intergenic
1162205606 19:9053963-9053985 CAAAACTTCCACAATGTGGAAGG - Intergenic
1166227514 19:41405844-41405866 CACAACCTGCCCGCTCTGGATGG - Intronic
1166268133 19:41697319-41697341 CAGAACCAGCAGCATCTGGCTGG - Intronic
1166572257 19:43804704-43804726 CAGAAACTGGAGAATCAGGAAGG - Intronic
1166748289 19:45152290-45152312 CAGAACGTGCTCGACCTGGACGG - Exonic
1166825679 19:45607501-45607523 CAGAACCTGGGCAATGGGGAAGG + Intronic
1167850637 19:52198615-52198637 CAGAACATGCACATTCTTGGAGG - Intronic
1168315807 19:55484321-55484343 TAGAGTCTGGACAATCTGGATGG - Exonic
924989829 2:303702-303724 CTGAGCCTGCACAATCTCCAAGG + Intergenic
925785994 2:7431669-7431691 CAGAACCTGGACACACTGGGTGG + Intergenic
926252556 2:11164050-11164072 CAGAACCTGCCGGATTTGGAAGG - Intronic
927050966 2:19328793-19328815 TAGAACCAGCAGATTCTGGAGGG + Intergenic
928921149 2:36529309-36529331 CAGAAACTGGCCAATCTGGAAGG + Intronic
934491900 2:94767104-94767126 CAGACGCTGCACAGTTTGGAGGG - Intergenic
938301657 2:130218669-130218691 GAGAGCCAGAACAATCTGGATGG + Intergenic
938621551 2:133059858-133059880 CAGAACCTGCAATATCTCCAAGG + Intronic
939727547 2:145741585-145741607 CATAACCTGTAAAAACTGGATGG - Intergenic
943443445 2:187952751-187952773 CAAAACTTCCACAATGTGGAAGG - Intergenic
945774926 2:214094649-214094671 CAGAACTTACACAATTTGTATGG + Intronic
948565771 2:238885104-238885126 CTGCATCTGCACAATCTGGGAGG - Intronic
1172232948 20:33349346-33349368 CAGAATCTTCTCAATCTGCAGGG - Intergenic
1173916722 20:46713546-46713568 CAGATCCTGCAGAGTCTTGAAGG + Intronic
1181764918 22:25084521-25084543 CACACCCTGCAGAATCTGGGAGG - Intronic
1182715171 22:32352543-32352565 CATCTCCTGCAGAATCTGGAGGG - Intergenic
1182926871 22:34133428-34133450 CAGAACCTGAACAACATGGAAGG - Intergenic
1183515680 22:38264490-38264512 CATACCCTGCACAAGCTGCAGGG + Intronic
1183999626 22:41663614-41663636 CAGAACCTTCATTATCTGGGGGG - Exonic
1185299133 22:50070383-50070405 CAGGGCCTGCACAATGAGGAAGG - Intronic
949977790 3:9476696-9476718 TGGAACCTGCACCAACTGGAGGG + Exonic
952081580 3:29764789-29764811 CATAGCCTGCATATTCTGGAAGG - Intronic
952477690 3:33727744-33727766 CATATCCTGTACATTCTGGATGG - Intergenic
953714766 3:45307680-45307702 CAAAGCCTCCACAATGTGGAAGG - Intergenic
954192259 3:48972013-48972035 CAGAACGTGCAAAATCTGTAGGG - Intronic
954444738 3:50540591-50540613 CAGCCCCTGCACAGTCTGCAGGG - Intergenic
955647362 3:61154374-61154396 AAGAACCTGCAGAATCAGAAAGG + Intronic
956096660 3:65723358-65723380 CAGAACATCCAGTATCTGGAAGG + Intronic
956150151 3:66232732-66232754 CAGAACCTCCAGAGCCTGGAAGG + Intronic
957169360 3:76718046-76718068 CATAACCTGCCCAAACTGGATGG + Intronic
959111316 3:102126199-102126221 CAGAACCTGCAATATCTGTGAGG + Intronic
960556932 3:119040163-119040185 CAGACCCTGCACAGGATGGATGG + Intronic
962147270 3:132853879-132853901 CAGAAACTCCACAAGCTAGAAGG - Intergenic
964444144 3:156741375-156741397 CAAAACTTCCACAATGTGGAAGG - Intergenic
965824749 3:172719309-172719331 CACAGCCTCCACAATCTCGATGG + Intergenic
967425299 3:189319888-189319910 CAGCACCTGCAAAAGCTGTAAGG - Intronic
968332309 3:197881452-197881474 CATAACAAACACAATCTGGAAGG - Intronic
968572535 4:1349607-1349629 GAGTTCCTCCACAATCTGGAAGG - Exonic
970229860 4:13898542-13898564 CATAAACTGGACAAACTGGATGG - Intergenic
970230374 4:13903970-13903992 GAGAAGTTGCACAAGCTGGAGGG + Intergenic
973244356 4:47995011-47995033 CAGAAACTGTACAAGCTAGAAGG - Intronic
973643761 4:52929616-52929638 CAGAACTTGCACAGTCTTAAAGG + Intronic
973676481 4:53268577-53268599 CAGAGCCTGCAGAATGAGGAGGG + Intronic
975766705 4:77676187-77676209 CCTAACCTGCACAGTCTGGGGGG - Intergenic
977414646 4:96717054-96717076 CAGAAAATGCTCCATCTGGAAGG + Intergenic
977620094 4:99126198-99126220 CAGACCCTTCACAATCAGAATGG - Intronic
983072604 4:163287092-163287114 CAGAAACTTCACAAGCTAGAAGG - Intergenic
986435655 5:7727676-7727698 CAGAACTTGGACAAAATGGATGG - Intronic
986703385 5:10433389-10433411 CAGAAGCAGCACAGGCTGGAAGG - Intronic
987119805 5:14756400-14756422 CAGATCCTGCCCAAACTTGAAGG - Intronic
988089107 5:26512749-26512771 AAGTACCTGCACATTATGGAAGG - Intergenic
990243701 5:53840548-53840570 CTGAAGCTGCACAAGCTAGAAGG + Intergenic
991491068 5:67183041-67183063 GAAAACCTGCACAAACTTGAAGG - Exonic
991561407 5:67957564-67957586 CAGAAGCCACACAATCTTGAAGG - Intergenic
991749268 5:69781860-69781882 CAGAACTGGCACAATTTAGAAGG + Intergenic
991800849 5:70361667-70361689 CAGAACTGGCACAATTTAGAAGG + Intergenic
991827751 5:70648374-70648396 CAGAACTGGCACAATTTAGAAGG - Intergenic
991893211 5:71361118-71361140 CAGAACTGGCACAATTTAGAAGG + Intergenic
993501344 5:88671306-88671328 CAAAATATGCAGAATCTGGAGGG + Intergenic
994195080 5:96913969-96913991 CAGAACCAAAACAATTTGGAGGG - Intronic
996159030 5:120139689-120139711 AAGAACCTGAACAATCTAGTAGG - Intergenic
999393667 5:151212872-151212894 CAGAACCATCACAAACTGGTAGG + Intronic
1000681790 5:164194331-164194353 CAGAGGCTCCACCATCTGGAAGG + Intergenic
1002485192 5:179530412-179530434 CGGGACCAGCACACTCTGGACGG - Intergenic
1008305479 6:49893697-49893719 CAGAAACACCACAAGCTGGAAGG + Intergenic
1010408408 6:75532739-75532761 CAGAACCTGGAAAGTGTGGAAGG + Intergenic
1010633530 6:78229684-78229706 CAGAAACTGTACAAGCTAGAAGG - Intergenic
1013313060 6:108915584-108915606 CAAATCCTGCACAATCTTCAGGG - Intronic
1015585430 6:134771406-134771428 CAGAACTTGCAGAATATGAATGG - Intergenic
1016216165 6:141606598-141606620 CAGAAACTTCACAAGCTAGAAGG - Intergenic
1017111462 6:150936845-150936867 CAGAGCCTGCACAAGCCCGATGG - Exonic
1020011209 7:4806814-4806836 CAGCACCTGCAGAATCCGAAGGG - Intronic
1020111549 7:5450840-5450862 CAGAGCCTGCAGAATCTGGAAGG - Intronic
1020855551 7:13416952-13416974 CAGAAGCTGCAAAGTCTGTAGGG + Intergenic
1021012641 7:15490647-15490669 CATAAACTGAACAATCTGCAAGG + Intronic
1022229236 7:28397465-28397487 CAATACCCCCACAATCTGGAGGG - Intronic
1023760753 7:43463038-43463060 CAGAGCCTGCACACATTGGAAGG + Intronic
1028097283 7:86777017-86777039 AAGTACCTGCTAAATCTGGATGG + Intronic
1032701790 7:134387615-134387637 CAGAACCTACAAAATCTCCAAGG + Intergenic
1032758568 7:134915863-134915885 CAGGGCCTGCTCAATGTGGAGGG - Intronic
1035048850 7:155986744-155986766 CAGAACCTTCACAAACACGAGGG - Intergenic
1037122862 8:15310283-15310305 CAGAACCTGGGCACTCTAGAGGG + Intergenic
1037201257 8:16255472-16255494 CAGAACACGCACATTCTGGTGGG - Intronic
1039365062 8:36920528-36920550 AAGAACCTGGACAAGCTGGCAGG - Intronic
1042573165 8:70189403-70189425 CAGAGACTGGACAATCTTGAGGG - Intronic
1047325286 8:123830020-123830042 TTGAACCTGCACAATCTGGAGGG - Intergenic
1049767056 8:144359731-144359753 CAGCACCTGCACCACCCGGATGG - Exonic
1050647470 9:7736410-7736432 CAGAACCTACAATATCTGCATGG - Intergenic
1054116780 9:61171340-61171362 CAAAACTTCCACACTCTGGAAGG + Intergenic
1056025841 9:82494653-82494675 CAGAAACTGTACAAGCTAGAAGG - Intergenic
1056322563 9:85450742-85450764 CAGAAACTGTACAAGCTAGAAGG - Intergenic
1056884467 9:90427912-90427934 CAAAACTTCCACAATGTGGAAGG + Intergenic
1056990154 9:91403167-91403189 AGGAACCTGCAGAATCTGGAAGG - Intergenic
1060293305 9:122324414-122324436 CAGCACCTCACCAATCTGGAAGG + Intergenic
1061278142 9:129581406-129581428 GAGAATCTGCAGAATCTGTAGGG - Intergenic
1062569518 9:137178717-137178739 CAGACCCTCCACAAGCTGCAAGG + Intronic
1186761329 X:12725613-12725635 CAAAAACTGCACAATTTTGAAGG - Intergenic
1187312765 X:18161576-18161598 CAGGAGCTGCTCAATCTGAATGG + Intergenic
1188540795 X:31248291-31248313 CTGAACCTGCAAAATCTCCAAGG + Intronic
1193040716 X:77000924-77000946 CAGAAGCTTCACAACTTGGATGG + Intergenic
1193271211 X:79531536-79531558 CAAACCCTCCACAATGTGGAAGG - Intergenic
1193994508 X:88347793-88347815 CAGAAACTTTACAAGCTGGATGG + Intergenic
1195879603 X:109578697-109578719 CTGAGCCTACATAATCTGGAAGG - Intergenic
1200960122 Y:8988805-8988827 CAGAGCTTCCACAATGTGGAAGG - Intergenic