ID: 913370311

View in Genome Browser
Species Human (GRCh38)
Location 1:118091911-118091933
Sequence CAGCCGATTTCATACATGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913370308_913370311 2 Left 913370308 1:118091886-118091908 CCAGCTCATGGTGTTGATCCTCC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 913370311 1:118091911-118091933 CAGCCGATTTCATACATGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913370311 Original CRISPR CAGCCGATTTCATACATGCC TGG Exonic
904593612 1:31629011-31629033 CAGCCCATTTCCTCCATGACTGG - Intronic
905299457 1:36976607-36976629 CAGTCGATTTCATACCTCCTGGG - Intronic
907693619 1:56697399-56697421 CTGCTGATTTCATACAGGCAAGG + Intronic
907784267 1:57596508-57596530 GAGCCGATTACATGCCTGCCAGG + Intronic
913370311 1:118091911-118091933 CAGCCGATTTCATACATGCCTGG + Exonic
913586804 1:120283004-120283026 CAGTGGATTTCATAAATTCCAGG - Intergenic
913621382 1:120615366-120615388 CAGTGGATTTCATAAATTCCAGG + Intergenic
914568819 1:148894889-148894911 CAGTGGATTTCATAAATTCCAGG - Intronic
914604009 1:149235367-149235389 CAGTGGATTTCATAAATTCCAGG + Intergenic
922418699 1:225444855-225444877 CAGCCAATTTCACACAGTCCAGG - Intergenic
1067750385 10:48967718-48967740 CACCCGACTTCATACATACATGG - Intronic
1071723917 10:88176926-88176948 CAGCAGATTTCTTAGAGGCCAGG - Intergenic
1076086053 10:127633289-127633311 CAGCAGAAATCATACAAGCCAGG - Intergenic
1078445081 11:11397949-11397971 CAGCCGCTTGCATCCATGCCTGG + Intronic
1083128302 11:60595932-60595954 CAGCAGATATCATGCAGGCCAGG + Intergenic
1094449591 12:30570770-30570792 GTGCCGCTTTCATACATGCATGG - Intergenic
1095407707 12:41886013-41886035 CAGCCACTTTCATACATGGTTGG - Intergenic
1098613245 12:72487445-72487467 CAGCAGATATCTTACAGGCCAGG + Intronic
1099743520 12:86671422-86671444 CAGCAGAAATCTTACATGCCAGG + Intronic
1105478790 13:20754316-20754338 CAGCAGAAATCTTACATGCCAGG - Intronic
1124099509 15:26680235-26680257 CAGCAGATTTCAGAATTGCCAGG + Intronic
1127047378 15:55041542-55041564 CAGCAGAAATCATACAAGCCAGG - Intergenic
1139874713 16:70136336-70136358 CAGCAGAGTTCATTCCTGCCAGG - Exonic
1140361071 16:74344807-74344829 CAGCAGAGTTCATTCCTGCCAGG + Intergenic
1155358357 18:24976158-24976180 CAGCTTATGACATACATGCCTGG - Intergenic
1163252883 19:16136903-16136925 CAGGGGATTTTATAGATGCCTGG - Intronic
930942061 2:57025388-57025410 CACCAGATTTCAGACTTGCCTGG - Intergenic
933899989 2:86842709-86842731 CAGGCTATTTCCTCCATGCCTGG + Intronic
938933590 2:136109060-136109082 GAGCAGCTTTCATACTTGCCTGG + Intergenic
940638931 2:156328425-156328447 CTGCCGATTTCAGAAGTGCCTGG - Exonic
942059425 2:172214453-172214475 TAGCAGATTTCATACAAGTCAGG - Intergenic
944931872 2:204528223-204528245 TTGCCTATTTCATATATGCCAGG + Intergenic
1171867653 20:30500205-30500227 CCGCCGATCTCATTCTTGCCAGG - Intergenic
1174353887 20:49985844-49985866 GTGCCGATTTCACACTTGCCAGG + Intronic
1175331583 20:58168308-58168330 CAGCCGTTTTCAAACCTGCTGGG + Intergenic
1176425350 21:6545308-6545330 CAGCCGGTTTCAGACACGCTGGG + Intergenic
1179331212 21:40403543-40403565 CAGCCGATTTCTTACATGGGTGG + Intronic
1179700841 21:43153625-43153647 CAGCCGGTTTCAGACACGCTGGG + Intergenic
1181040592 22:20190712-20190734 CAGCCGGCTTCACAAATGCCAGG - Intergenic
954601491 3:51874117-51874139 CAGCTGTTTTCATCCAGGCCTGG - Exonic
965714345 3:171586649-171586671 CAGCCCATTTCAGACTCGCCAGG - Intergenic
968455278 4:695241-695263 CAGCCAATTTCACACATACGTGG + Intergenic
983265944 4:165508000-165508022 CACCTGATTTCAGACAAGCCAGG - Intergenic
985151513 4:186951989-186952011 CAGGCTACTTCATACATGCCTGG + Intergenic
993142998 5:84057461-84057483 CAGCCAATCTGATACATGACTGG + Intronic
994620654 5:102157566-102157588 CTGCAGATTTCAGACATGCCTGG - Intergenic
1000609685 5:163360348-163360370 CAGTAGATTTCATACTTGCATGG + Intergenic
1006381316 6:33699124-33699146 CAGCACATTTCAGACTTGCCAGG + Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1010630663 6:78193419-78193441 CAGCAGAAACCATACATGCCAGG - Intergenic
1017384164 6:153863086-153863108 CAGCAGATGTCTTACAGGCCAGG + Intergenic
1026392093 7:69912122-69912144 CACCCGAGTGCATGCATGCCTGG + Intronic
1030817016 7:114050894-114050916 CTGTGGATTTCATACTTGCCAGG + Intronic
1035395959 7:158534722-158534744 CAGCCGAGGTGAAACATGCCCGG - Intronic
1041994261 8:64034504-64034526 CAGGCTATATCATACATCCCAGG + Intergenic
1042128285 8:65560575-65560597 CAGCGCATTTCATTCCTGCCTGG + Intergenic
1047765773 8:127988712-127988734 CAGCCCATTTCATACATGGTGGG - Intergenic
1048743610 8:137589095-137589117 TTGCAGATTTCAGACATGCCAGG - Intergenic
1186317166 X:8383571-8383593 CAGACGATCCCATACATGCTAGG - Intergenic
1188534271 X:31178968-31178990 CAGCCAAATTAGTACATGCCAGG - Intronic
1189223266 X:39391127-39391149 CAGAAGATTTTATACTTGCCAGG - Intergenic
1194506610 X:94741569-94741591 CAGCCGAAACCATACAGGCCAGG - Intergenic
1196367058 X:114935112-114935134 GAGCAGATTTCTTACATGGCAGG + Intergenic
1199059004 X:143330896-143330918 CAGCAGATATCTTACAGGCCAGG + Intergenic
1199746812 X:150776858-150776880 CAGCTGATTTTATACATTTCGGG + Intronic