ID: 913372132

View in Genome Browser
Species Human (GRCh38)
Location 1:118111403-118111425
Sequence AGAAGGACCCGTGTGGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913372132 Original CRISPR AGAAGGACCCGTGTGGTTTC AGG (reversed) Intronic
902220138 1:14959399-14959421 AGAGGGACCAGTGTGGCTGCAGG + Intronic
903826020 1:26146260-26146282 AGAAGGATCCCTGTGGATCCAGG - Intergenic
904366962 1:30018581-30018603 AAAAGGCCCTGTGTGATTTCAGG + Intergenic
906052391 1:42886518-42886540 GGAGGGACCAGTGTGGTCTCAGG + Intergenic
910264955 1:85328689-85328711 AGTAGGACCCCAGTGGTTTGAGG + Intronic
911596463 1:99803552-99803574 AGATGAACCAGCGTGGTTTCAGG - Intergenic
913372132 1:118111403-118111425 AGAAGGACCCGTGTGGTTTCAGG - Intronic
919760805 1:201097037-201097059 AGAAAGACCCTGGAGGTTTCTGG - Intronic
922104456 1:222500795-222500817 AGAAGAGCCCGTGTGATATCGGG - Intergenic
922454262 1:225762203-225762225 GGAAGCACCAGTGTGGTTCCTGG - Intergenic
924346633 1:243078314-243078336 AGAAGATCCCGTGTGATATCGGG - Intergenic
924556124 1:245120187-245120209 AGAGGGATCCGAGTGGTTTTGGG - Intronic
924794868 1:247285897-247285919 AGGAGGACCCGTGTAGCTTTGGG - Intergenic
1066729717 10:38426535-38426557 AGAAGAGCCCGTGTGATATCGGG + Intergenic
1073556451 10:104456970-104456992 GGAAAGACCCTGGTGGTTTCTGG + Intergenic
1075296879 10:121285112-121285134 AAAAGGACACATGTGTTTTCAGG - Intergenic
1075524020 10:123167167-123167189 AGAAGAACCCCAGTGTTTTCTGG - Exonic
1075541396 10:123317249-123317271 AGAAGGAACCGTGTGCTTCTGGG - Intergenic
1076133532 10:128029463-128029485 AGAAGGCCCTGGGTGGTGTCTGG - Intronic
1076235529 10:128861218-128861240 AGAGGGACCGGTGAGGATTCTGG - Intergenic
1076395379 10:130134974-130134996 GGAAGGCCCAGTGTGGTTTGGGG + Intergenic
1080971352 11:37280764-37280786 AGAAGGAATCTTGAGGTTTCTGG - Intergenic
1089489110 11:118870636-118870658 AGAAGCACCAGTTTGTTTTCTGG + Intergenic
1094160947 12:27390128-27390150 GGAAGGACACGTGTGTATTCTGG + Exonic
1095115099 12:38343823-38343845 TGAAGGATCCCTGTGGTTCCAGG - Intergenic
1098981717 12:76963235-76963257 GGAAGGTCCCGTGAGGTTTTTGG + Intergenic
1099145445 12:79037731-79037753 AGAAGTACCTGTGGGGTTGCTGG - Intronic
1100052387 12:90464195-90464217 ATAAGGACAAGTGTGGATTCTGG - Intergenic
1102453194 12:113056566-113056588 AGAAGGCCCCTTGGGGTCTCGGG + Intergenic
1103402304 12:120651232-120651254 AATAGGACCCGAGTGGTTTTAGG + Intronic
1104159575 12:126165312-126165334 AGAATGACCAGTCTGGTTGCTGG + Intergenic
1111486343 13:88905631-88905653 TGAAGGACCGGTCTGGTTACTGG + Intergenic
1114131267 14:19796148-19796170 AGAAGGAAGAGTGTGGCTTCAGG + Intronic
1115958437 14:38808636-38808658 TGAAGGATCCCTGTGGTGTCAGG - Intergenic
1115969729 14:38932164-38932186 TGAAGGATCCCTGTGGTTTCAGG - Intergenic
1116045039 14:39733471-39733493 AGTAGGACCCATCTGGTTTTTGG - Intergenic
1116823914 14:49652694-49652716 AGATGGGACCGTCTGGTTTCAGG + Intronic
1119832783 14:77718213-77718235 AGAAGGACCAGTGCAGTTTGAGG - Exonic
1120901506 14:89579622-89579644 AGAAGGACCTGTGTGGCTGGAGG - Intronic
1127539406 15:59922028-59922050 AGAATGACTTGTGTGGATTCAGG + Intergenic
1133416222 16:5609179-5609201 AGAAGGCCCCAGGTAGTTTCAGG - Intergenic
1134260865 16:12649833-12649855 AGAAGTACCTGTGAGGTATCAGG - Intergenic
1140293304 16:73684677-73684699 AAAAGGACCCTTGTGATTGCAGG - Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142571579 17:878353-878375 AGAAGGCCAGGTGCGGTTTCGGG + Intronic
1142757839 17:2025972-2025994 GGAAGGACCCGTGCGGGTTCGGG + Intergenic
1144136830 17:12303031-12303053 AGAAGGACCAGTGTGGATTGAGG - Intergenic
1146803716 17:35848380-35848402 AGAAGGAAGAGTCTGGTTTCTGG + Intronic
1147858275 17:43499952-43499974 AGAGGGAGCCGTCTGGGTTCTGG - Exonic
1152263511 17:79279846-79279868 AAAAGGACCCGTGTTGTCTAGGG + Intronic
1155354069 18:24934764-24934786 AGCATAACCTGTGTGGTTTCTGG + Intergenic
1158660802 18:59385822-59385844 AGCAGGACCCGTGGAGTGTCAGG - Intergenic
1160779260 19:870719-870741 GGAAGGAGCCGTATGGATTCGGG + Intronic
1160779278 19:870766-870788 GGAGGGAGCCGTGTGGATTCGGG + Intronic
1160779296 19:870812-870834 GGAGGGAGCCGTGTGGATTCGGG + Intronic
1160779314 19:870858-870880 GGAGGGAGCCGTGTGGATTCGGG + Intronic
1160779347 19:870949-870971 GGAGGGAGCCGTGTGGATTCGGG + Intronic
1163085547 19:14977005-14977027 AGAAGCAGCATTGTGGTTTCAGG - Intronic
925750844 2:7089667-7089689 GGAAGGAACCGGGAGGTTTCTGG + Intergenic
927185434 2:20478931-20478953 AGGAGGTCCCATGTGGATTCTGG - Intergenic
928259668 2:29755397-29755419 AGAAGGAACCTTGCGGTTTTAGG + Intronic
932330404 2:70895429-70895451 AGAAGGACCCGTGGGCTGTAGGG - Intergenic
932871317 2:75401617-75401639 AAAAGAATCAGTGTGGTTTCAGG - Intergenic
933878958 2:86648735-86648757 AGAAGGACCTGAGTAGCTTCAGG - Intronic
938405045 2:131027855-131027877 AGAAGGAGCCCAGTGGGTTCAGG - Intronic
944322961 2:198369637-198369659 AGAAGGACTGCTGTGGTCTCAGG + Intronic
947187027 2:227464575-227464597 GGAAATACCAGTGTGGTTTCTGG - Intergenic
947643555 2:231721516-231721538 TGAAGGACCTGTGTGGTCTTTGG - Intergenic
948870013 2:240793086-240793108 AGTAGCACCCGTGTGGTCCCTGG - Intronic
949048653 2:241885125-241885147 AGAAGGAGCTGTGTGGATGCCGG - Intergenic
1171135279 20:22689674-22689696 AGAAGCACCCACGTGGTTCCTGG + Intergenic
1179582017 21:42350066-42350088 AGAAGGAGCAGTGTGGTCTGGGG - Intronic
1182004093 22:26944683-26944705 AGAAGGACCCTTGTGATTGCAGG + Intergenic
1182441654 22:30368114-30368136 AGAGGGACTCCAGTGGTTTCAGG + Intronic
1182770397 22:32791528-32791550 AGAAAGACCCATCTGGTTTCAGG + Intronic
1183395394 22:37568432-37568454 AGCAGGACCCGTGGGGGTTGCGG - Exonic
951538547 3:23761420-23761442 AGAAGGAGGCCTGTGGTTTGGGG - Intergenic
952156207 3:30646372-30646394 AGAGGGACCAGTGTGGTTAGAGG + Intronic
952861077 3:37812671-37812693 CGAAGGAACAGTGTGCTTTCTGG - Intronic
958908626 3:99968917-99968939 AGAAGGAAGGGTATGGTTTCTGG + Intronic
961034803 3:123634879-123634901 AGCAATACCCATGTGGTTTCTGG - Intronic
962271267 3:133979631-133979653 TGATGGGCCCGTGAGGTTTCTGG + Intronic
969701791 4:8771638-8771660 AGAATCACCCCTGTGATTTCAGG - Intergenic
970164198 4:13219078-13219100 AGAAGGATCCATGTTGGTTCAGG + Intergenic
971312769 4:25539922-25539944 AGATGTTCCCGTGTGGTTTAAGG - Intergenic
972457895 4:39272290-39272312 AGAAGCACCCCTGTGGCTTATGG - Intronic
979043796 4:115835311-115835333 AGAAGGGCCATTTTGGTTTCTGG - Intergenic
979256085 4:118609374-118609396 AGAAGAGCCCGTGTGATATCGGG + Intergenic
979332259 4:119431163-119431185 AGAAGAGCCCGTGTGATATCGGG - Intergenic
983014948 4:162602084-162602106 ACAAGGACCCTTGTGCTTCCTGG + Intergenic
985887171 5:2688665-2688687 AAAAGACCCAGTGTGGTTTCAGG - Intergenic
986300324 5:6473456-6473478 AGAAGGAGGCGTGTGTGTTCCGG - Intronic
986439001 5:7762200-7762222 AGGAGCACCCGTGTGGTTCATGG - Intronic
996307309 5:122062583-122062605 AGCAGGACATTTGTGGTTTCAGG + Intronic
997689516 5:135816593-135816615 AGAATGACTAGTGTAGTTTCTGG + Intergenic
1000779571 5:165464582-165464604 AGAAGGATCCCTGTGGTGCCAGG - Intergenic
1002096192 5:176832544-176832566 AGAAGGCCCTGTGTGGTGTGTGG + Intronic
1004417903 6:15441592-15441614 AGAAGGACCAGAGTGGGCTCTGG - Intronic
1004602878 6:17167476-17167498 AGCACGTCCCATGTGGTTTCAGG + Intergenic
1014007221 6:116433471-116433493 AGAAGGAACCGTGTGGTGGAAGG + Exonic
1017450634 6:154551696-154551718 AGAGGTACCTGTGAGGTTTCAGG + Intergenic
1022768473 7:33442364-33442386 AGAATGAGCAGTGTGGTTTGTGG + Intronic
1024071790 7:45792504-45792526 AGAAGAGCCCGTGTGATATCGGG + Intergenic
1040658095 8:49535677-49535699 AAAAGGACCCCTGGGGTTTGTGG - Intergenic
1046698656 8:117374459-117374481 AGGAGGAACCTTGTGGATTCAGG - Intergenic
1048842331 8:138576930-138576952 AGAAGGAACCTGGTGGTTTTTGG + Intergenic
1049291362 8:141804292-141804314 AGAAGGATCCGTGTGGGCACGGG - Intergenic
1060550150 9:124481178-124481200 AGAACGGCCCGGGTGGATTCCGG - Intergenic
1197518837 X:127472707-127472729 AGAAGGATCCCTGTGGTGCCAGG - Intergenic
1199485199 X:148339051-148339073 ACAAGCACCCCTGTGGCTTCAGG - Intergenic