ID: 913378563

View in Genome Browser
Species Human (GRCh38)
Location 1:118184366-118184388
Sequence CCTCATTTACTGAAGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913378557_913378563 7 Left 913378557 1:118184336-118184358 CCAGCTGCAGGTGACAAGAGCTA No data
Right 913378563 1:118184366-118184388 CCTCATTTACTGAAGCTGGGTGG 0: 1
1: 0
2: 0
3: 20
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913378563 Original CRISPR CCTCATTTACTGAAGCTGGG TGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
901303933 1:8218612-8218634 CCTCCTTTATGGAAGTTGGGTGG - Intergenic
901316998 1:8316300-8316322 CATGATTGACTGAAGGTGGGGGG - Intergenic
903948108 1:26976858-26976880 GCTCATTTACTGAAGAGGAGTGG + Intergenic
905896070 1:41546533-41546555 GCTCATCTCCTGAAGCTGTGAGG + Intronic
906794087 1:48682868-48682890 CCTCATTTAATGGAGCTGGTGGG + Intronic
908034309 1:60035351-60035373 ACCCATTTACTGCAGCTGGTAGG + Intronic
909591872 1:77359601-77359623 CCTCATTTATTTCAGCTGGCTGG - Intronic
910449548 1:87331610-87331632 CCTCATTTGCTGGAGGCGGGCGG + Intronic
912586455 1:110771413-110771435 CCTCATTTCCAGAAACTGGTTGG - Intergenic
913378563 1:118184366-118184388 CCTCATTTACTGAAGCTGGGTGG + Intronic
916346189 1:163794028-163794050 CATCAATTACAGAAGCTGTGTGG - Intergenic
917767867 1:178243386-178243408 CCTCATTTTCACAGGCTGGGAGG - Intronic
918046229 1:180942595-180942617 CCGCAGATATTGAAGCTGGGGGG + Intronic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
919316983 1:195983238-195983260 CCTAATTAACAGAAGCTGTGTGG + Intergenic
919812019 1:201414691-201414713 CCTCATTCCCTGATGCCGGGTGG - Intronic
920684871 1:208101761-208101783 CCACAGGCACTGAAGCTGGGAGG + Intronic
924471903 1:244350073-244350095 TCTCATTTCCTGCAGCAGGGGGG - Intergenic
1062894870 10:1095529-1095551 GCTCCTTTAGAGAAGCTGGGTGG + Intronic
1064687202 10:17875093-17875115 CACCAGTTACTGAAGATGGGTGG + Exonic
1068211856 10:53930768-53930790 CCTGATTGACTAAAGCTAGGGGG - Intronic
1070713229 10:78698708-78698730 CCTCCTCTGCTGAAGCGGGGTGG - Intergenic
1071580821 10:86768136-86768158 CCTCAATTACTGAACCTAAGAGG + Intronic
1071941325 10:90594735-90594757 CCTGCTCTCCTGAAGCTGGGGGG - Intergenic
1073006805 10:100330723-100330745 ACCCATTGACTGAACCTGGGAGG - Intergenic
1075741532 10:124699124-124699146 CCTCATTTAATGAACATGGCAGG + Intronic
1076674918 10:132142702-132142724 CCTCCCTTACTGAGGCTCGGAGG + Intronic
1078871108 11:15345950-15345972 CCTCATTTTCTAAAGCAGGGTGG + Intergenic
1080408724 11:32003358-32003380 CCACATCTCCTGAAGCTGGGAGG + Intronic
1084563139 11:69915159-69915181 CCTCACTTACACAAACTGGGTGG + Intergenic
1086221934 11:84456150-84456172 GCTCATTCACTGAAGCTGCATGG + Intronic
1087873732 11:103330743-103330765 CCTCTTGTACTGAAACTGGCCGG + Intronic
1088709216 11:112491635-112491657 CTGCATTTCCTGAAGCAGGGAGG + Intergenic
1089348057 11:117804236-117804258 CCTCAGTTACAGAATCTGAGAGG + Intronic
1089434249 11:118450351-118450373 CCTCTTTTTCTGAAGCAGGGTGG + Intronic
1089894199 11:121911799-121911821 CCTCATTTTCTATAGCTGTGTGG - Intergenic
1090852872 11:130585713-130585735 ACTCAATGACTGAACCTGGGTGG + Intergenic
1091397483 12:162977-162999 CCTCATTTACTGTGGCTCAGTGG + Intronic
1092166559 12:6346279-6346301 TCTCCTTTACTAAAGCTGGGAGG + Intergenic
1092969382 12:13677293-13677315 TCTCATTCAATGAAACTGGGAGG + Intronic
1094022181 12:25926216-25926238 CCTCATTTCCTGAGGCAGAGTGG - Intergenic
1095457632 12:42405745-42405767 CCTCAATTACTGGAACTTGGGGG + Intronic
1101853703 12:108424790-108424812 CCTCATCTTCTGTAGCTGGAAGG - Intergenic
1102071538 12:110023941-110023963 CTTCACTAACTTAAGCTGGGGGG + Intronic
1105253071 13:18718392-18718414 CATGATTTACAGAAGCTGAGTGG + Intergenic
1105776905 13:23670791-23670813 CCTCATTTAGTGCTGCTGGGAGG - Intronic
1107096670 13:36545050-36545072 CTTCTCTTACTGAAGGTGGGTGG - Intergenic
1108861602 13:54867332-54867354 CATCCTTTACTGAAGCAGGCAGG - Intergenic
1109558845 13:64020285-64020307 CCTCATTTAATGAAGCCAGCTGG + Intergenic
1111533962 13:89577232-89577254 ACTCATTTACTGCAGCAGGTGGG - Intergenic
1115654985 14:35434832-35434854 CCTCATTCACTGAAACTAGGTGG - Intergenic
1119755606 14:77116556-77116578 CATCTTTTACTGAAACAGGGAGG - Exonic
1120400034 14:84019283-84019305 CCTCATTTCCTGAATCTGCTTGG + Intergenic
1123900352 15:24870712-24870734 CCTCACTAAAGGAAGCTGGGAGG - Intronic
1128259381 15:66221909-66221931 CCTGATTTCCTCAAGCTGGCCGG + Intronic
1129677375 15:77639232-77639254 CCCAACTTACTGAAACTGGGAGG + Intronic
1130780648 15:87036043-87036065 CCTCATTTCCTGATTCTGGAGGG + Intergenic
1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG + Intronic
1133767085 16:8845510-8845532 CCTCAGTCACTGAGGCGGGGAGG + Intronic
1140406199 16:74713343-74713365 CCTCATCTGCGGAGGCTGGGAGG + Exonic
1144366043 17:14545799-14545821 CCTCACCTACTGCAGATGGGAGG + Intergenic
1144848713 17:18233374-18233396 CCCCATCTGCAGAAGCTGGGAGG - Intronic
1151264852 17:72946899-72946921 CAGCAATTACTGAAGCTGGGTGG - Intronic
1155131103 18:22935217-22935239 CAACAATTTCTGAAGCTGGGTGG - Intronic
1157384941 18:47252556-47252578 CCTCATTTAGGGAAACTGTGAGG - Intergenic
1160021376 18:75184315-75184337 CCTCATTTACACAAGGAGGGAGG + Intergenic
1161062310 19:2221446-2221468 CCTCATTGGCAGAAGCAGGGAGG + Intronic
1164526563 19:29017436-29017458 GCTCATTGGCTGAAGCTGAGGGG + Intergenic
1166416152 19:42596053-42596075 TCTCATGTACACAAGCTGGGGGG - Intronic
1168651711 19:58096385-58096407 CTTCATTTGCTGAGGCTGGGGGG - Intronic
925965418 2:9061050-9061072 CCTCATTCTTTGCAGCTGGGTGG + Intergenic
926863497 2:17334183-17334205 TCCCTTTTACTGAATCTGGGAGG + Intergenic
928283721 2:29971005-29971027 CTTCATATACTGATGCTTGGTGG - Intergenic
928292348 2:30050608-30050630 CCCCATTCACTGAGGCTGGCTGG - Intergenic
929834702 2:45384741-45384763 CCTCATTCATTTAAGCTGAGGGG - Intergenic
930133395 2:47876430-47876452 CCTCACTTACAGAAGCTTGATGG - Intronic
930234740 2:48877717-48877739 TCTCTCTTACTGAGGCTGGGTGG - Intergenic
932751349 2:74373615-74373637 CCTCCTTTCCTACAGCTGGGTGG - Intronic
932866017 2:75343992-75344014 ACTCAATTCCTGAGGCTGGGAGG + Intergenic
933678488 2:85078349-85078371 GCTCATTAAGGGAAGCTGGGTGG - Intergenic
938016948 2:127875071-127875093 CCACATTTTGTTAAGCTGGGTGG - Intronic
940116923 2:150219490-150219512 CATCATTTCCTGAAGCCTGGAGG - Intergenic
942095794 2:172535593-172535615 CCTCCTTCCATGAAGCTGGGGGG - Intergenic
945159334 2:206873022-206873044 CCTCATTCAGAGAGGCTGGGAGG + Intergenic
946442454 2:219708146-219708168 CCTCATTTGATGAAGCCTGGGGG - Intergenic
946849358 2:223890045-223890067 CCTCATATACAGAGGCTGTGTGG - Intronic
1169761482 20:9099964-9099986 CGTCATTGTGTGAAGCTGGGTGG + Intronic
1169932343 20:10848012-10848034 CCTCAATCAACGAAGCTGGGGGG - Intergenic
1170643616 20:18177425-18177447 CCCCACCCACTGAAGCTGGGTGG - Intronic
1170858096 20:20076177-20076199 CCTCTCTTCCTGAAGCTGGGTGG + Intronic
1173080358 20:39861423-39861445 TCTCATTTACTGAGGCTGATGGG - Intergenic
1173910069 20:46661624-46661646 CCCCATTTCCTGCACCTGGGAGG + Intronic
1175422591 20:58844015-58844037 CTTCATTTTCTGCAGCTGTGTGG + Intronic
1176424879 21:6542230-6542252 CCTCCTTTACTCAAGGTGGACGG - Intergenic
1176838576 21:13818277-13818299 CATGATTTACAGAAGCTGAGTGG + Intergenic
1178127614 21:29532515-29532537 CCTCATACACTGAGGCTGAGAGG + Intronic
1178613752 21:34111642-34111664 CCTCAATTACTGAAACATGGAGG - Intronic
1179171978 21:38980202-38980224 CCTGAGTTACTGAAGCCGTGCGG + Intergenic
1179399738 21:41072760-41072782 CCTCATACACTCATGCTGGGCGG - Intergenic
1179700368 21:43150539-43150561 CCTCCTTTACTCAAGGTGGACGG - Intergenic
953407699 3:42667657-42667679 CCTCATCTCCTGACTCTGGGTGG - Intergenic
953890058 3:46744668-46744690 CCTCATTGACCCCAGCTGGGTGG - Exonic
954786093 3:53093583-53093605 CCTCATGTGCAGAATCTGGGTGG - Intronic
956774477 3:72553503-72553525 CCTCATTTACACAAGCTGCCAGG - Intergenic
958999394 3:100944848-100944870 CCTCATATACTAAGGCTGAGTGG + Intronic
962985244 3:140530614-140530636 CCACATCTGCTGAAGCTGGATGG - Intronic
964042552 3:152279617-152279639 CCATATCTACTGAAGATGGGAGG - Intronic
970008215 4:11429739-11429761 CCTCTATTCCGGAAGCTGGGAGG + Exonic
970209661 4:13696278-13696300 ATTCATTTAGTGCAGCTGGGTGG + Intergenic
978746405 4:112199581-112199603 CACCATTTACTGATGCTAGGTGG + Intergenic
981541526 4:145851408-145851430 CCTCATTGTTAGAAGCTGGGAGG + Intronic
983752833 4:171298382-171298404 CCTCATTTCCTGGGGCTGGCAGG - Intergenic
985311677 4:188608189-188608211 CATCATTTACTCAAGGTGGCAGG + Intergenic
987761607 5:22170469-22170491 AATCATTACCTGAAGCTGGGAGG + Intronic
990547559 5:56837937-56837959 CCTCATTAACTGAAGCTCTAGGG - Intronic
990682257 5:58258189-58258211 CTGCATTTACTGAGGCAGGGTGG + Intergenic
991256689 5:64622052-64622074 CCTCATCTTCTGTAGCTGGAGGG - Intergenic
991292084 5:65042900-65042922 CTTCATTTACTGAGACTGTGAGG - Intergenic
995209887 5:109525702-109525724 CTTCAGTTTCTCAAGCTGGGAGG + Intergenic
996524516 5:124463885-124463907 CATCATTTACTCAAACTGGGAGG + Intergenic
999175771 5:149630685-149630707 CCCCATTGACTGGAGCTGGGCGG - Intronic
1000217024 5:159169323-159169345 GCTCATTTACAGAATCTGGTTGG - Intronic
1004235551 6:13872174-13872196 CCTCATTTCCTGGGGCTGGCAGG + Intergenic
1011191731 6:84737009-84737031 CATGATATACTGGAGCTGGGGGG + Exonic
1015183470 6:130386224-130386246 CCTCATTCACTGAAGCTCAGAGG + Intronic
1016805924 6:148212014-148212036 ACTCTTTTCCTGAAGCTGAGAGG - Intergenic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1024423780 7:49202002-49202024 CCTCAGTTATACAAGCTGGGAGG + Intergenic
1026086275 7:67265778-67265800 ACTCACTCACTGAAGCTGGGGGG + Intergenic
1026690871 7:72549039-72549061 ACTCACTCACTGAAGCTGGGGGG - Intergenic
1029413280 7:100428694-100428716 CCTCATTGGCAGAAGCTGGGGGG + Intronic
1029469407 7:100744722-100744744 CAGCATTTACTGAAGCTGCTGGG - Intronic
1029627909 7:101731928-101731950 CCTCATTACCTGCACCTGGGAGG + Intergenic
1030076700 7:105743109-105743131 AATCAATTACAGAAGCTGGGAGG - Intronic
1033349027 7:140546798-140546820 CCTCAGTTCCTGAACCTGGCAGG + Exonic
1038268226 8:26052159-26052181 CCGCATTAAACGAAGCTGGGAGG + Intergenic
1044634303 8:94307292-94307314 TCTCATTTACTGTAGCTGAGAGG + Intergenic
1045102764 8:98861986-98862008 GCACATTTACTGAATCTGGCAGG - Intronic
1045519851 8:102894255-102894277 CAACATGTACTGAAGCTGGGAGG + Intronic
1045870030 8:106915925-106915947 CCTCCTTTACACAAGATGGGTGG - Intergenic
1046986437 8:120393309-120393331 CCTCTTATACTGAAGTTGTGTGG + Intronic
1047665040 8:127082319-127082341 CCTCACTTATGGAAGGTGGGAGG - Intergenic
1049963352 9:756984-757006 CCTCATTTGCTGAGGTTGAGAGG + Intergenic
1051220043 9:14838636-14838658 CAACATTTACTGAAACTAGGAGG - Intronic
1051359878 9:16272610-16272632 CTTCATTAACTGAAAGTGGGTGG + Intronic
1051422893 9:16906014-16906036 CCTCCTTTGCAGAAGCTGGCTGG - Intergenic
1051569876 9:18543807-18543829 CCTAACTTACTGGGGCTGGGGGG - Intronic
1053265587 9:36710871-36710893 CCTCACTTTCTGAAGCTCTGGGG - Intergenic
1055144167 9:72912742-72912764 GCTCATTTAATGAAGCAGGATGG - Intronic
1056958229 9:91099534-91099556 CTTCATTTTCTGAACCTGGCAGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057507380 9:95646847-95646869 CTACAATTGCTGAAGCTGGGCGG - Intergenic
1058205440 9:102100325-102100347 TCTCATTTACTACAGCTGGAAGG + Intergenic
1059331782 9:113540136-113540158 CTTCATTATCTGTAGCTGGGGGG + Intronic
1061166170 9:128923376-128923398 CCTCCTTTATTGAAGCTGGCAGG - Intronic
1062399643 9:136366747-136366769 CCTCACTTGGGGAAGCTGGGAGG + Intronic
1187081469 X:15993728-15993750 CTTTATTTTCTGAAGATGGGGGG + Intergenic
1190049448 X:47138744-47138766 CATGATTTACTGAAGCTGATTGG + Intergenic
1190115820 X:47625913-47625935 CCCCACTTCCTGCAGCTGGGAGG + Intronic
1192927876 X:75775904-75775926 CCTCATGTACTAACTCTGGGGGG + Intergenic
1196782794 X:119398784-119398806 CCTCATTGACAGAGGCTGTGTGG - Intergenic
1197029164 X:121792793-121792815 CCTCTTTTAGTAAAGATGGGAGG - Intergenic
1197874043 X:131085373-131085395 CCTCCTCTACAGAACCTGGGTGG - Intronic
1198268682 X:135033573-135033595 CCCCATTTACAGAACCAGGGAGG - Intergenic
1198848909 X:140943900-140943922 CCTGATTTACCAAAGCGGGGAGG - Intergenic