ID: 913382275

View in Genome Browser
Species Human (GRCh38)
Location 1:118225460-118225482
Sequence CCTTCTGAGCATGAACTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913382275_913382277 -3 Left 913382275 1:118225460-118225482 CCTTGCAGTTCATGCTCAGAAGG No data
Right 913382277 1:118225480-118225502 AGGACAGAGCAACCAACGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913382275 Original CRISPR CCTTCTGAGCATGAACTGCA AGG (reversed) Intergenic
No off target data available for this crispr