ID: 913384413

View in Genome Browser
Species Human (GRCh38)
Location 1:118243792-118243814
Sequence GCCCCAACCCAACAACTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913384411_913384413 14 Left 913384411 1:118243755-118243777 CCTAAACAAACAAACAAACAAAC No data
Right 913384413 1:118243792-118243814 GCCCCAACCCAACAACTGATAGG No data
913384410_913384413 15 Left 913384410 1:118243754-118243776 CCCTAAACAAACAAACAAACAAA No data
Right 913384413 1:118243792-118243814 GCCCCAACCCAACAACTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913384413 Original CRISPR GCCCCAACCCAACAACTGAT AGG Intergenic