ID: 913386767

View in Genome Browser
Species Human (GRCh38)
Location 1:118266443-118266465
Sequence GTGAGCTGAACTTGAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913386766_913386767 -5 Left 913386766 1:118266425-118266447 CCAAGATGGGGCAAAACAGTGAG No data
Right 913386767 1:118266443-118266465 GTGAGCTGAACTTGAACTGCTGG No data
913386762_913386767 15 Left 913386762 1:118266405-118266427 CCAAAAAATGGTGATAAGATCCA No data
Right 913386767 1:118266443-118266465 GTGAGCTGAACTTGAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913386767 Original CRISPR GTGAGCTGAACTTGAACTGC TGG Intergenic
No off target data available for this crispr