ID: 913391970

View in Genome Browser
Species Human (GRCh38)
Location 1:118324123-118324145
Sequence CTCTGTTAGATACACCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913391970_913391975 21 Left 913391970 1:118324123-118324145 CCCTCCAGGTGTATCTAACAGAG No data
Right 913391975 1:118324167-118324189 AAATTGACTTAAGTAGGTTATGG No data
913391970_913391974 15 Left 913391970 1:118324123-118324145 CCCTCCAGGTGTATCTAACAGAG No data
Right 913391974 1:118324161-118324183 TTCAAGAAATTGACTTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913391970 Original CRISPR CTCTGTTAGATACACCTGGA GGG (reversed) Intergenic
No off target data available for this crispr