ID: 913393267

View in Genome Browser
Species Human (GRCh38)
Location 1:118338301-118338323
Sequence ATGTCCTAATTGAAGTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913393265_913393267 19 Left 913393265 1:118338259-118338281 CCTTTGTGTATCTGGAGAATAAA No data
Right 913393267 1:118338301-118338323 ATGTCCTAATTGAAGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913393267 Original CRISPR ATGTCCTAATTGAAGTCTTC AGG Intergenic
No off target data available for this crispr