ID: 913397492

View in Genome Browser
Species Human (GRCh38)
Location 1:118388391-118388413
Sequence AAGCAGAAGCAGAATGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913397491_913397492 -2 Left 913397491 1:118388370-118388392 CCTTTTTCATTATGGGTTGCTAA No data
Right 913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG No data
913397490_913397492 -1 Left 913397490 1:118388369-118388391 CCCTTTTTCATTATGGGTTGCTA No data
Right 913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913397492 Original CRISPR AAGCAGAAGCAGAATGACTC TGG Intergenic
No off target data available for this crispr