ID: 913401196

View in Genome Browser
Species Human (GRCh38)
Location 1:118435415-118435437
Sequence AACCCAAGGCTATCACAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913401196_913401199 9 Left 913401196 1:118435415-118435437 CCACACTGTGATAGCCTTGGGTT No data
Right 913401199 1:118435447-118435469 CTTCTTTTTCTGGTTTCTTAAGG 0: 2
1: 55
2: 249
3: 738
4: 2283
913401196_913401200 12 Left 913401196 1:118435415-118435437 CCACACTGTGATAGCCTTGGGTT No data
Right 913401200 1:118435450-118435472 CTTTTTCTGGTTTCTTAAGGTGG 0: 10
1: 41
2: 152
3: 401
4: 1086
913401196_913401198 -1 Left 913401196 1:118435415-118435437 CCACACTGTGATAGCCTTGGGTT No data
Right 913401198 1:118435437-118435459 TTTTTTTGCTCTTCTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913401196 Original CRISPR AACCCAAGGCTATCACAGTG TGG (reversed) Intergenic
No off target data available for this crispr