ID: 913405421

View in Genome Browser
Species Human (GRCh38)
Location 1:118485732-118485754
Sequence CTGCATGGAGATAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913405421_913405427 -4 Left 913405421 1:118485732-118485754 CCTGCCTCCTTATCTCCATGCAG No data
Right 913405427 1:118485751-118485773 GCAGACTGTTATCACCTTTGGGG No data
913405421_913405426 -5 Left 913405421 1:118485732-118485754 CCTGCCTCCTTATCTCCATGCAG No data
Right 913405426 1:118485750-118485772 TGCAGACTGTTATCACCTTTGGG No data
913405421_913405425 -6 Left 913405421 1:118485732-118485754 CCTGCCTCCTTATCTCCATGCAG No data
Right 913405425 1:118485749-118485771 ATGCAGACTGTTATCACCTTTGG No data
913405421_913405428 6 Left 913405421 1:118485732-118485754 CCTGCCTCCTTATCTCCATGCAG No data
Right 913405428 1:118485761-118485783 ATCACCTTTGGGGTGAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913405421 Original CRISPR CTGCATGGAGATAAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr