ID: 913405427

View in Genome Browser
Species Human (GRCh38)
Location 1:118485751-118485773
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913405418_913405427 29 Left 913405418 1:118485699-118485721 CCATGGTACTATCAAACCCTACA No data
Right 913405427 1:118485751-118485773 GCAGACTGTTATCACCTTTGGGG No data
913405420_913405427 12 Left 913405420 1:118485716-118485738 CCTACAGAAGAGCTTACCTGCCT No data
Right 913405427 1:118485751-118485773 GCAGACTGTTATCACCTTTGGGG No data
913405421_913405427 -4 Left 913405421 1:118485732-118485754 CCTGCCTCCTTATCTCCATGCAG No data
Right 913405427 1:118485751-118485773 GCAGACTGTTATCACCTTTGGGG No data
913405422_913405427 -8 Left 913405422 1:118485736-118485758 CCTCCTTATCTCCATGCAGACTG No data
Right 913405427 1:118485751-118485773 GCAGACTGTTATCACCTTTGGGG No data
913405419_913405427 13 Left 913405419 1:118485715-118485737 CCCTACAGAAGAGCTTACCTGCC No data
Right 913405427 1:118485751-118485773 GCAGACTGTTATCACCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr