ID: 913405428

View in Genome Browser
Species Human (GRCh38)
Location 1:118485761-118485783
Sequence ATCACCTTTGGGGTGAGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913405424_913405428 -9 Left 913405424 1:118485747-118485769 CCATGCAGACTGTTATCACCTTT No data
Right 913405428 1:118485761-118485783 ATCACCTTTGGGGTGAGCATTGG No data
913405421_913405428 6 Left 913405421 1:118485732-118485754 CCTGCCTCCTTATCTCCATGCAG No data
Right 913405428 1:118485761-118485783 ATCACCTTTGGGGTGAGCATTGG No data
913405422_913405428 2 Left 913405422 1:118485736-118485758 CCTCCTTATCTCCATGCAGACTG No data
Right 913405428 1:118485761-118485783 ATCACCTTTGGGGTGAGCATTGG No data
913405420_913405428 22 Left 913405420 1:118485716-118485738 CCTACAGAAGAGCTTACCTGCCT No data
Right 913405428 1:118485761-118485783 ATCACCTTTGGGGTGAGCATTGG No data
913405419_913405428 23 Left 913405419 1:118485715-118485737 CCCTACAGAAGAGCTTACCTGCC No data
Right 913405428 1:118485761-118485783 ATCACCTTTGGGGTGAGCATTGG No data
913405423_913405428 -1 Left 913405423 1:118485739-118485761 CCTTATCTCCATGCAGACTGTTA No data
Right 913405428 1:118485761-118485783 ATCACCTTTGGGGTGAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913405428 Original CRISPR ATCACCTTTGGGGTGAGCAT TGG Intergenic
No off target data available for this crispr