ID: 913412021

View in Genome Browser
Species Human (GRCh38)
Location 1:118562601-118562623
Sequence TTGGATATGAATAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913412011_913412021 19 Left 913412011 1:118562559-118562581 CCTTGGGAAAAGCATGCCTTTTC No data
Right 913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG No data
913412014_913412021 3 Left 913412014 1:118562575-118562597 CCTTTTCAGTAAATGGTTCTGGT No data
Right 913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG No data
913412010_913412021 24 Left 913412010 1:118562554-118562576 CCATGCCTTGGGAAAAGCATGCC No data
Right 913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913412021 Original CRISPR TTGGATATGAATAAGGGGGA GGG Intergenic
No off target data available for this crispr