ID: 913414944

View in Genome Browser
Species Human (GRCh38)
Location 1:118594764-118594786
Sequence ACTGTAAGGTCCACAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913414944_913414948 18 Left 913414944 1:118594764-118594786 CCTGACTTTGTGGACCTTACAGT No data
Right 913414948 1:118594805-118594827 TTAGTGCTGTCATGTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913414944 Original CRISPR ACTGTAAGGTCCACAAAGTC AGG (reversed) Intergenic
No off target data available for this crispr