ID: 913416963

View in Genome Browser
Species Human (GRCh38)
Location 1:118619387-118619409
Sequence GGGAGAGCACAACAATTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913416963_913416969 26 Left 913416963 1:118619387-118619409 CCTCACAATTGTTGTGCTCTCCC No data
Right 913416969 1:118619436-118619458 CTCCCTATGCTGCCACTGCCAGG No data
913416963_913416972 28 Left 913416963 1:118619387-118619409 CCTCACAATTGTTGTGCTCTCCC No data
Right 913416972 1:118619438-118619460 CCCTATGCTGCCACTGCCAGGGG No data
913416963_913416970 27 Left 913416963 1:118619387-118619409 CCTCACAATTGTTGTGCTCTCCC No data
Right 913416970 1:118619437-118619459 TCCCTATGCTGCCACTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913416963 Original CRISPR GGGAGAGCACAACAATTGTG AGG (reversed) Intergenic
No off target data available for this crispr