ID: 913416965

View in Genome Browser
Species Human (GRCh38)
Location 1:118619408-118619430
Sequence TGATTCTGTGTGGTGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913416965_913416972 7 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416972 1:118619438-118619460 CCCTATGCTGCCACTGCCAGGGG No data
913416965_913416982 24 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416982 1:118619455-118619477 CAGGGGACGGGCAGCGGGGGTGG No data
913416965_913416980 21 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416980 1:118619452-118619474 TGCCAGGGGACGGGCAGCGGGGG No data
913416965_913416977 18 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416977 1:118619449-118619471 CACTGCCAGGGGACGGGCAGCGG No data
913416965_913416974 11 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416974 1:118619442-118619464 ATGCTGCCACTGCCAGGGGACGG No data
913416965_913416975 12 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416975 1:118619443-118619465 TGCTGCCACTGCCAGGGGACGGG No data
913416965_913416979 20 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416979 1:118619451-118619473 CTGCCAGGGGACGGGCAGCGGGG No data
913416965_913416970 6 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416970 1:118619437-118619459 TCCCTATGCTGCCACTGCCAGGG No data
913416965_913416969 5 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416969 1:118619436-118619458 CTCCCTATGCTGCCACTGCCAGG No data
913416965_913416978 19 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416978 1:118619450-118619472 ACTGCCAGGGGACGGGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913416965 Original CRISPR TGATTCTGTGTGGTGGAGAA TGG (reversed) Intergenic