ID: 913416967

View in Genome Browser
Species Human (GRCh38)
Location 1:118619418-118619440
Sequence GGGAGGAGAATGATTCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913416967_913416969 -5 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416969 1:118619436-118619458 CTCCCTATGCTGCCACTGCCAGG No data
913416967_913416980 11 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416980 1:118619452-118619474 TGCCAGGGGACGGGCAGCGGGGG No data
913416967_913416982 14 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416982 1:118619455-118619477 CAGGGGACGGGCAGCGGGGGTGG No data
913416967_913416974 1 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416974 1:118619442-118619464 ATGCTGCCACTGCCAGGGGACGG No data
913416967_913416972 -3 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416972 1:118619438-118619460 CCCTATGCTGCCACTGCCAGGGG No data
913416967_913416977 8 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416977 1:118619449-118619471 CACTGCCAGGGGACGGGCAGCGG No data
913416967_913416979 10 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416979 1:118619451-118619473 CTGCCAGGGGACGGGCAGCGGGG No data
913416967_913416975 2 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416975 1:118619443-118619465 TGCTGCCACTGCCAGGGGACGGG No data
913416967_913416978 9 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416978 1:118619450-118619472 ACTGCCAGGGGACGGGCAGCGGG No data
913416967_913416970 -4 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416970 1:118619437-118619459 TCCCTATGCTGCCACTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913416967 Original CRISPR GGGAGGAGAATGATTCTGTG TGG (reversed) Intergenic
No off target data available for this crispr