ID: 913416969

View in Genome Browser
Species Human (GRCh38)
Location 1:118619436-118619458
Sequence CTCCCTATGCTGCCACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913416966_913416969 -2 Left 913416966 1:118619415-118619437 CCACCACACAGAATCATTCTCCT No data
Right 913416969 1:118619436-118619458 CTCCCTATGCTGCCACTGCCAGG No data
913416967_913416969 -5 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416969 1:118619436-118619458 CTCCCTATGCTGCCACTGCCAGG No data
913416964_913416969 6 Left 913416964 1:118619407-118619429 CCCATTCTCCACCACACAGAATC No data
Right 913416969 1:118619436-118619458 CTCCCTATGCTGCCACTGCCAGG No data
913416965_913416969 5 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416969 1:118619436-118619458 CTCCCTATGCTGCCACTGCCAGG No data
913416963_913416969 26 Left 913416963 1:118619387-118619409 CCTCACAATTGTTGTGCTCTCCC No data
Right 913416969 1:118619436-118619458 CTCCCTATGCTGCCACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913416969 Original CRISPR CTCCCTATGCTGCCACTGCC AGG Intergenic
No off target data available for this crispr