ID: 913416974

View in Genome Browser
Species Human (GRCh38)
Location 1:118619442-118619464
Sequence ATGCTGCCACTGCCAGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913416964_913416974 12 Left 913416964 1:118619407-118619429 CCCATTCTCCACCACACAGAATC No data
Right 913416974 1:118619442-118619464 ATGCTGCCACTGCCAGGGGACGG No data
913416967_913416974 1 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416974 1:118619442-118619464 ATGCTGCCACTGCCAGGGGACGG No data
913416966_913416974 4 Left 913416966 1:118619415-118619437 CCACCACACAGAATCATTCTCCT No data
Right 913416974 1:118619442-118619464 ATGCTGCCACTGCCAGGGGACGG No data
913416965_913416974 11 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416974 1:118619442-118619464 ATGCTGCCACTGCCAGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913416974 Original CRISPR ATGCTGCCACTGCCAGGGGA CGG Intergenic
No off target data available for this crispr