ID: 913416977

View in Genome Browser
Species Human (GRCh38)
Location 1:118619449-118619471
Sequence CACTGCCAGGGGACGGGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913416966_913416977 11 Left 913416966 1:118619415-118619437 CCACCACACAGAATCATTCTCCT No data
Right 913416977 1:118619449-118619471 CACTGCCAGGGGACGGGCAGCGG No data
913416964_913416977 19 Left 913416964 1:118619407-118619429 CCCATTCTCCACCACACAGAATC No data
Right 913416977 1:118619449-118619471 CACTGCCAGGGGACGGGCAGCGG No data
913416968_913416977 -9 Left 913416968 1:118619435-118619457 CCTCCCTATGCTGCCACTGCCAG No data
Right 913416977 1:118619449-118619471 CACTGCCAGGGGACGGGCAGCGG No data
913416967_913416977 8 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416977 1:118619449-118619471 CACTGCCAGGGGACGGGCAGCGG No data
913416965_913416977 18 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416977 1:118619449-118619471 CACTGCCAGGGGACGGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913416977 Original CRISPR CACTGCCAGGGGACGGGCAG CGG Intergenic
No off target data available for this crispr