ID: 913416980

View in Genome Browser
Species Human (GRCh38)
Location 1:118619452-118619474
Sequence TGCCAGGGGACGGGCAGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913416965_913416980 21 Left 913416965 1:118619408-118619430 CCATTCTCCACCACACAGAATCA No data
Right 913416980 1:118619452-118619474 TGCCAGGGGACGGGCAGCGGGGG No data
913416966_913416980 14 Left 913416966 1:118619415-118619437 CCACCACACAGAATCATTCTCCT No data
Right 913416980 1:118619452-118619474 TGCCAGGGGACGGGCAGCGGGGG No data
913416968_913416980 -6 Left 913416968 1:118619435-118619457 CCTCCCTATGCTGCCACTGCCAG No data
Right 913416980 1:118619452-118619474 TGCCAGGGGACGGGCAGCGGGGG No data
913416967_913416980 11 Left 913416967 1:118619418-118619440 CCACACAGAATCATTCTCCTCCC No data
Right 913416980 1:118619452-118619474 TGCCAGGGGACGGGCAGCGGGGG No data
913416971_913416980 -9 Left 913416971 1:118619438-118619460 CCCTATGCTGCCACTGCCAGGGG No data
Right 913416980 1:118619452-118619474 TGCCAGGGGACGGGCAGCGGGGG No data
913416964_913416980 22 Left 913416964 1:118619407-118619429 CCCATTCTCCACCACACAGAATC No data
Right 913416980 1:118619452-118619474 TGCCAGGGGACGGGCAGCGGGGG No data
913416973_913416980 -10 Left 913416973 1:118619439-118619461 CCTATGCTGCCACTGCCAGGGGA No data
Right 913416980 1:118619452-118619474 TGCCAGGGGACGGGCAGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913416980 Original CRISPR TGCCAGGGGACGGGCAGCGG GGG Intergenic
No off target data available for this crispr