ID: 913426598

View in Genome Browser
Species Human (GRCh38)
Location 1:118738181-118738203
Sequence CAGCATCTGATGGGATCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913426598_913426604 7 Left 913426598 1:118738181-118738203 CCTTAGGATCCCATCAGATGCTG No data
Right 913426604 1:118738211-118738233 GCTGGCAGCCCCTAGTGATGGGG No data
913426598_913426602 5 Left 913426598 1:118738181-118738203 CCTTAGGATCCCATCAGATGCTG No data
Right 913426602 1:118738209-118738231 GTGCTGGCAGCCCCTAGTGATGG No data
913426598_913426603 6 Left 913426598 1:118738181-118738203 CCTTAGGATCCCATCAGATGCTG No data
Right 913426603 1:118738210-118738232 TGCTGGCAGCCCCTAGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913426598 Original CRISPR CAGCATCTGATGGGATCCTA AGG (reversed) Intergenic
No off target data available for this crispr