ID: 913426598 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:118738181-118738203 |
Sequence | CAGCATCTGATGGGATCCTA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
913426598_913426604 | 7 | Left | 913426598 | 1:118738181-118738203 | CCTTAGGATCCCATCAGATGCTG | No data | ||
Right | 913426604 | 1:118738211-118738233 | GCTGGCAGCCCCTAGTGATGGGG | No data | ||||
913426598_913426602 | 5 | Left | 913426598 | 1:118738181-118738203 | CCTTAGGATCCCATCAGATGCTG | No data | ||
Right | 913426602 | 1:118738209-118738231 | GTGCTGGCAGCCCCTAGTGATGG | No data | ||||
913426598_913426603 | 6 | Left | 913426598 | 1:118738181-118738203 | CCTTAGGATCCCATCAGATGCTG | No data | ||
Right | 913426603 | 1:118738210-118738232 | TGCTGGCAGCCCCTAGTGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
913426598 | Original CRISPR | CAGCATCTGATGGGATCCTA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |