ID: 913428930

View in Genome Browser
Species Human (GRCh38)
Location 1:118767327-118767349
Sequence GCACCCAATACGTTTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913428930_913428932 8 Left 913428930 1:118767327-118767349 CCTCCTTTAAACGTATTGGGTGC No data
Right 913428932 1:118767358-118767380 TCCCATTATTATTAACCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913428930 Original CRISPR GCACCCAATACGTTTAAAGG AGG (reversed) Intergenic
No off target data available for this crispr