ID: 913435606

View in Genome Browser
Species Human (GRCh38)
Location 1:118844538-118844560
Sequence ATGAAGGAGCTAAATGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913435606_913435610 18 Left 913435606 1:118844538-118844560 CCATCATCATTTAGCTCCTTCAT No data
Right 913435610 1:118844579-118844601 AGCTCCTTTTGGATCAAGACTGG No data
913435606_913435609 7 Left 913435606 1:118844538-118844560 CCATCATCATTTAGCTCCTTCAT No data
Right 913435609 1:118844568-118844590 TGAGTTACAGCAGCTCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913435606 Original CRISPR ATGAAGGAGCTAAATGATGA TGG (reversed) Intergenic
No off target data available for this crispr