ID: 913439048

View in Genome Browser
Species Human (GRCh38)
Location 1:118878044-118878066
Sequence TAGGAAAAGCAGATTGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913439046_913439048 1 Left 913439046 1:118878020-118878042 CCTTATCTTTGACTGCTGGGTTT No data
Right 913439048 1:118878044-118878066 TAGGAAAAGCAGATTGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913439048 Original CRISPR TAGGAAAAGCAGATTGAGAT TGG Intergenic
No off target data available for this crispr