ID: 913439447

View in Genome Browser
Species Human (GRCh38)
Location 1:118882408-118882430
Sequence TTGAATGCATCACTGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913439447_913439450 26 Left 913439447 1:118882408-118882430 CCATGCTGCAGTGATGCATTCAA 0: 1
1: 0
2: 1
3: 9
4: 192
Right 913439450 1:118882457-118882479 ATATACCAAGCAAAATCCAGAGG 0: 1
1: 0
2: 0
3: 11
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913439447 Original CRISPR TTGAATGCATCACTGCAGCA TGG (reversed) Intergenic
901107497 1:6768564-6768586 TTGAAGGACTAACTGCAGCAGGG + Intergenic
903436318 1:23352427-23352449 TTGATTGTACCACTGCAGCCTGG + Intergenic
911436807 1:97870487-97870509 TTAAGTGCATGACTGCAGGAAGG + Intronic
913439447 1:118882408-118882430 TTGAATGCATCACTGCAGCATGG - Intergenic
921906007 1:220496262-220496284 GTGAATTCATTACTGCAGGAAGG + Intergenic
922451121 1:225738138-225738160 TTCAATGCAGAACTGCAGAAAGG - Intergenic
1063676249 10:8142797-8142819 TTAAATGAATGACTGTAGCACGG - Intergenic
1063879348 10:10515014-10515036 GTAAATGCATCATAGCAGCAAGG + Intergenic
1063905904 10:10779928-10779950 GTGGATGGATCACTGCAGAAAGG + Intergenic
1064472601 10:15652347-15652369 TGGAATGAATCCGTGCAGCAGGG + Intronic
1068177818 10:53485097-53485119 TTGAGTACATCACTACAACATGG - Intergenic
1068281886 10:54883017-54883039 CTGACAGCATCACTGCAGCTTGG - Intronic
1068731493 10:60363229-60363251 TTGAATGCAGATTTGCAGCATGG + Intronic
1070035730 10:72721769-72721791 AGTAATGCATCACTACAGCAAGG - Intronic
1070397425 10:76023655-76023677 TTGACTGAAATACTGCAGCAAGG + Intronic
1070716886 10:78729045-78729067 GTGGCTGCATCACTGCAGAACGG + Intergenic
1070804398 10:79262401-79262423 CTGAATGATTCACTGCAGCCTGG - Intronic
1071377612 10:85024869-85024891 TTGACTGCAGCATTGCACCAGGG + Intergenic
1071458041 10:85866245-85866267 TTAAAGGCATCACTGCAGGTGGG - Intronic
1071973870 10:90935593-90935615 GAAAATGCATCACAGCAGCAAGG - Intergenic
1072984796 10:100130245-100130267 ATGAATGCACCACTGCAGCAGGG + Intergenic
1073607628 10:104912274-104912296 TTGAAGGCATTAAGGCAGCATGG - Intronic
1075646113 10:124097672-124097694 ATGGATGCATTACTGCAGAAGGG - Intergenic
1076490504 10:130858260-130858282 TTGATTGCATGAAGGCAGCAGGG - Intergenic
1079181404 11:18196895-18196917 TTGATTTCATCACTGCAGTGTGG + Intronic
1079277519 11:19055833-19055855 TTGATTTCATCACTGCAGCGTGG - Exonic
1085039395 11:73317970-73317992 TTGAAGGCCTCACAGCAGGAAGG - Intronic
1085564574 11:77501543-77501565 TTGTATGGATCACTGGAACAGGG - Intergenic
1087168914 11:95030924-95030946 TGGGAAGCATCACTGCAGGATGG - Intergenic
1091116052 11:133014606-133014628 TTGAATGCATCACCGAATGAAGG - Intronic
1092981009 12:13794162-13794184 TTCATTGCACCACTGCAGCCTGG + Intronic
1094773796 12:33697603-33697625 TTGAATGCAAAAATGGAGCAAGG - Intergenic
1095151262 12:38799172-38799194 TTGAACTCATCTCTGCACCAAGG + Intronic
1096189209 12:49604210-49604232 TGGAATGCTTCACTGGAGAAGGG + Intronic
1097676401 12:62606773-62606795 ATGATTGCACCACTGCAGCCTGG + Intergenic
1099630594 12:85138538-85138560 CTCAATGTATCACTGCAGGAAGG + Intronic
1100112152 12:91258916-91258938 TTGAATTCATGCCTGCAGGATGG + Intergenic
1100322287 12:93507272-93507294 CTGAATGCATAACTGGAACAAGG - Exonic
1102804139 12:115764441-115764463 TTGAACCAATCACTGCAGCCAGG - Intergenic
1104086208 12:125476437-125476459 TTGATTTCATCCCTGTAGCAGGG + Intronic
1104302838 12:127581276-127581298 TTGAATGCATTCCTGCAGAGGGG + Intergenic
1104838703 12:131809382-131809404 GTGGGTGCATCACAGCAGCATGG - Intergenic
1106023195 13:25933664-25933686 TTGAGTGCAGCACTGAAGCTGGG - Intronic
1106222281 13:27756432-27756454 TTGAATGAATCACTGAACCTGGG - Intergenic
1106302572 13:28482607-28482629 GTGAATGAATTACTCCAGCAAGG + Intronic
1107741159 13:43452080-43452102 TTAAATGCTTCACCACAGCAGGG + Intronic
1107802790 13:44126087-44126109 TTCTATGCATCACTGCAGCCAGG + Intergenic
1108215122 13:48176410-48176432 TTCAATTCATCACTGAAGGAAGG - Intergenic
1109610118 13:64753866-64753888 TTGAAAGTATGACTGCAGCATGG + Intergenic
1110795654 13:79634471-79634493 TTGAATGCATGACTGGGCCAGGG + Intergenic
1112261978 13:97885410-97885432 TTGAGTGCATCACTCCACCTAGG + Intergenic
1115832798 14:37361336-37361358 TTGAATGCAGCTCTGCACCAAGG - Intronic
1116713694 14:48401013-48401035 TTGAATGCATCTTTTCAGTAGGG + Intergenic
1117138981 14:52766890-52766912 TTTAATGAAACAATGCAGCATGG - Intronic
1118725642 14:68627189-68627211 TTAAAGGCCACACTGCAGCAAGG - Intronic
1119103239 14:71899567-71899589 TTGAACCAATCACTTCAGCAAGG - Intergenic
1119532443 14:75372371-75372393 TTCAATGCTTCTCTGCAGCTGGG + Intergenic
1123436170 15:20256202-20256224 TTGAATGCATCACTTGACCAAGG + Intergenic
1128025227 15:64430443-64430465 TTGACTGCAACAATGCATCAAGG + Intronic
1128602913 15:69012807-69012829 TTGAAAGCAGAACTGGAGCAGGG - Intronic
1129056035 15:72821265-72821287 TAGAATGCATGACTCCAGGAAGG + Intergenic
1129223026 15:74144658-74144680 ATGAATGCCACACTGGAGCATGG + Intergenic
1131908915 15:97174428-97174450 CTAAATGCAACACTGCACCAGGG + Intergenic
1132235159 15:100214418-100214440 ATGAATGAATCACTTCAGCCTGG - Intronic
1132362393 15:101227420-101227442 TTGAATGCAGCACTGCCCAAGGG + Intronic
1132664840 16:1076630-1076652 TTGAAAGATTCACTGGAGCAGGG - Intergenic
1136385751 16:29925169-29925191 TTGAATGCAACACTCCAAGAAGG + Intronic
1136848431 16:33594782-33594804 TTGAATGCATCACTTGACAAAGG - Intergenic
1137835166 16:51584775-51584797 ATCAAAGCTTCACTGCAGCATGG - Intergenic
1138721036 16:59079133-59079155 GAGATTGCATCACTGCAGCCTGG + Intergenic
1139000259 16:62501291-62501313 TTGAAGGCACCCCTGCAGCTGGG + Intergenic
1203110138 16_KI270728v1_random:1443431-1443453 TTGAATGCATCACTTGACAAAGG - Intergenic
1146043619 17:29482800-29482822 GTATATGCATCACTGTAGCAGGG + Intronic
1148451580 17:47781450-47781472 TGGAAAGCATCTCTACAGCACGG - Intergenic
1148819547 17:50352719-50352741 TTGAAGGGATCCCTGCAGCGGGG - Intronic
1152189642 17:78880648-78880670 ATGAATGCACCACTGCACCTCGG + Intronic
1152241882 17:79165200-79165222 TTGAATGGCTCACCGCAGCCTGG - Intronic
1155278586 18:24214659-24214681 TTGAATGTAACTCTGGAGCAAGG + Intronic
1156661401 18:39350748-39350770 ATGAATGCACCACTCCAGTATGG - Intergenic
1157574066 18:48732107-48732129 GTGAATGCACTGCTGCAGCATGG - Intronic
1158075314 18:53521245-53521267 TTGAATGCATAACTGTTGCCTGG + Intronic
1158168773 18:54573029-54573051 TTGAATTCAGCTCTGCACCAAGG - Intergenic
1158211866 18:55060055-55060077 TGGAATGTAGCTCTGCAGCATGG - Intergenic
1160181146 18:76637900-76637922 TTGATTGCATGAGTGCAGCTGGG - Intergenic
1163083406 19:14960535-14960557 GTGAATAAATCACTGCAGAAAGG + Intronic
1163802884 19:19378015-19378037 GTGATTGCATCTCTGCACCAAGG - Intergenic
1165032321 19:33007118-33007140 TTGAATGCATCACTTGACAAAGG + Intronic
1167647705 19:50714645-50714667 ATGATTGCACCACTGCAGCCCGG + Intronic
925202433 2:1979395-1979417 TTAATTTCATCAGTGCAGCAGGG + Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
930008155 2:46914574-46914596 TTAAATGTATAAATGCAGCATGG - Intronic
930974100 2:57433468-57433490 TTGCATGCCTCACTCCATCATGG - Intergenic
933694531 2:85207741-85207763 TTGAATACAGCACTGAAGTACGG - Intronic
935138170 2:100326147-100326169 ATGATTGCACCACTGCAGCCTGG + Intergenic
937453253 2:122019797-122019819 TTTAAAGCACCACAGCAGCACGG + Intergenic
938451070 2:131420900-131420922 TTCTATGCATCACTGCTGCTAGG + Intergenic
939708274 2:145481899-145481921 TGAAATGCAGCACTGTAGCATGG + Intergenic
941569574 2:167153486-167153508 ATGGATGCAGCACAGCAGCACGG - Intronic
945334589 2:208577622-208577644 TTAAATGCAACACTGAAGCCAGG - Intronic
946131090 2:217607500-217607522 TTGAAAGCCTCCCTGCAGCAGGG + Intronic
948141537 2:235676173-235676195 TTGAATGAATCACAGCCTCATGG + Intronic
1168890927 20:1295024-1295046 GTGAATGCTTCCCTCCAGCATGG + Intronic
1169607709 20:7341130-7341152 ATGGGTGCATCACAGCAGCATGG - Intergenic
1170109434 20:12789141-12789163 TTGAAGGCATCACTGTAGAAGGG - Intergenic
1172204735 20:33155199-33155221 ATGATTGCATCACTCCAGCCTGG - Intergenic
1177717027 21:24852107-24852129 ATGAGTGCAGCACAGCAGCATGG + Intergenic
1179713287 21:43275109-43275131 CTGAAACCATCACTGCTGCAGGG - Intergenic
1180097668 21:45566212-45566234 TTGAAGGTTTCACTGCATCATGG + Intergenic
1182894976 22:33851620-33851642 TTCATTGGTTCACTGCAGCAAGG + Intronic
1183204136 22:36406835-36406857 TTGATGGCATCAGTCCAGCATGG + Intergenic
1184156074 22:42668077-42668099 TTGACTTCATCAGTGCAGGAGGG - Intergenic
1185003273 22:48259660-48259682 GTGAATACTTCTCTGCAGCACGG - Intergenic
952352153 3:32550495-32550517 TTGCAGCCATCACTACAGCATGG + Intronic
953684637 3:45067056-45067078 TTGAGGGCATCACTGCTGCTGGG - Intergenic
953762858 3:45705817-45705839 TTCAATGCATCAGTGGAACAGGG + Intronic
954659706 3:52220522-52220544 GTGGGTGCATCCCTGCAGCAGGG - Intergenic
954989169 3:54824499-54824521 TTGCATTCATCATTGCAGAAGGG + Intronic
957308889 3:78493067-78493089 ATGGATGCAGCACAGCAGCATGG + Intergenic
957860670 3:85944395-85944417 TTGAATTCAGCTCTGCACCAAGG + Intronic
958452195 3:94287489-94287511 TTTAATCCATGACTGCAGAATGG - Intergenic
958983227 3:100749453-100749475 ATGACTGCAACAGTGCAGCAAGG + Exonic
959074089 3:101732233-101732255 TTGAAAACATCACAGCAGCCAGG - Intronic
960621295 3:119638999-119639021 ATGATTGCATCACTGCCACAGGG - Intronic
962991090 3:140578051-140578073 TTGAATTCCTCAGGGCAGCAGGG + Intergenic
965437603 3:168671771-168671793 ATGAAAACATCAGTGCAGCAAGG + Intergenic
965568665 3:170149310-170149332 TTGATTGCCTAACTGCAGCTCGG - Intronic
965923534 3:173949313-173949335 TTAAATGTATCACTGCTGCTAGG - Intronic
969151537 4:5173822-5173844 TTGAACTCAGCACTGCACCAAGG - Intronic
971588231 4:28432607-28432629 TTGACCCCATCCCTGCAGCAGGG - Intergenic
974578191 4:63756658-63756680 ATGAGTGCAGCACAGCAGCATGG + Intergenic
977394702 4:96455613-96455635 TGGGATACATCACAGCAGCAGGG - Intergenic
979973130 4:127162289-127162311 TTGAATGTGTCAGTGCACCAAGG + Intergenic
982488203 4:155994763-155994785 TGGCATGAATCACTGCAGTATGG + Intergenic
983969015 4:173848579-173848601 GTGAAAGGATCACTGGAGCATGG - Intergenic
984091892 4:175385968-175385990 ATGATTGCATCACTGCAGTCTGG - Intergenic
984953396 4:185022673-185022695 TTTAATGCTTCACTGCCGAAGGG - Intergenic
991243269 5:64483157-64483179 ATGGGTGCAGCACTGCAGCATGG + Intergenic
992082847 5:73251462-73251484 TTGAATGTCACACTCCAGCAGGG + Intergenic
992382548 5:76252415-76252437 TTAAATGTATCACTGCGGCTGGG - Intronic
994333863 5:98540800-98540822 ATGACTGCAACACTCCAGCAAGG + Intergenic
995475620 5:112545219-112545241 GTGATTGCATCACTGCACCAAGG - Intergenic
996020720 5:118588084-118588106 TTGAATGCAGCCCTGTACCACGG - Intergenic
996080010 5:119247353-119247375 TTTAAGGCATCAGTGCATCAAGG - Exonic
997606475 5:135178692-135178714 TTGAGTGCATCACGGAGGCAGGG + Intronic
998155691 5:139785737-139785759 TTGAATGAATCAGTGAAGGAAGG + Intergenic
998158698 5:139800809-139800831 TTGAGAACATCACTCCAGCAGGG + Intronic
999031743 5:148300630-148300652 TTTATTGCATCAATGCATCATGG + Intergenic
999183076 5:149683828-149683850 AAGATTGCACCACTGCAGCAAGG - Intergenic
999776672 5:154817485-154817507 ATGAATGAATCACTTCAGCCTGG - Exonic
1000037677 5:157461136-157461158 TTGAAAGCTTCACTGTAGAAGGG - Intronic
1000556962 5:162737765-162737787 TTTAAGGCATCACTTCAGCAAGG + Intergenic
1000670953 5:164062429-164062451 TTTAATGCATGCCTGCAGGATGG + Intergenic
1000997133 5:167970826-167970848 TTGTAAGCTTCAGTGCAGCAGGG + Intronic
1001760988 5:174207915-174207937 TTGAATCCATCACTGTGGCCAGG - Intronic
1002364275 5:178697906-178697928 TTGATTGAATAACTGCAACAGGG + Intergenic
1003302218 6:4893847-4893869 TTGAATGCACCAAAGCAGGACGG - Intronic
1004781023 6:18908867-18908889 TTGAATGAATAAATGCAGTAAGG + Intergenic
1005618163 6:27595193-27595215 GTGATTACATCACTGGAGCATGG - Intergenic
1006345297 6:33476145-33476167 TTGCATGCTTCACTCCAGCCTGG + Intergenic
1007999980 6:46350211-46350233 TTTAATGCATGAATGGAGCAGGG + Intronic
1008114693 6:47534841-47534863 GTGACTGCACCACTGCAGCCAGG - Intronic
1008640067 6:53453383-53453405 TGGAATTCATCACTCCACCAAGG - Intergenic
1008810863 6:55497112-55497134 ATGAATGCATAAAGGCAGCATGG + Intronic
1011774756 6:90717219-90717241 TGGAATCCATCACTGCTGTAGGG - Intergenic
1016031715 6:139344702-139344724 GTGACTGCATCACTCCAGGAAGG + Intergenic
1016279085 6:142393166-142393188 TTAAAACCATCGCTGCAGCATGG - Intronic
1017195433 6:151695176-151695198 TTGAATGCATACCTGGAGCTTGG + Intronic
1021293219 7:18871326-18871348 TTGATTCCAGCACTGCATCAGGG - Intronic
1021630205 7:22637565-22637587 ATGATTGCATCACTCCAGCCTGG - Intergenic
1022200690 7:28114213-28114235 GTGAAAGCATCAGTGGAGCATGG - Intronic
1023525788 7:41101386-41101408 TGGCATGCATCAAGGCAGCAAGG + Intergenic
1023847964 7:44133714-44133736 ATGAATGAATCACTTCAGCCTGG + Intergenic
1024923056 7:54581032-54581054 GTTAATGCAGCACTGAAGCAGGG + Intergenic
1027345720 7:77257692-77257714 TTGAATCCGTCACTGCAGTGTGG - Intronic
1029807064 7:103009324-103009346 TTCAATCCATCAAGGCAGCAGGG + Intronic
1036712732 8:11092053-11092075 TTGTATGCTTAACTGCAGAATGG - Intronic
1037087812 8:14874834-14874856 TTGAATGGATAACTGGAGGAAGG - Intronic
1038290450 8:26244614-26244636 ATGATTGCACCACTGCAGCCTGG + Intergenic
1039930569 8:41984345-41984367 CTGCATGCATGCCTGCAGCATGG - Intronic
1040098064 8:43467470-43467492 TAGAAGGCATCCCTGTAGCATGG + Intergenic
1040530293 8:48261201-48261223 TTGAATGAATGAATGAAGCAAGG - Intergenic
1042159660 8:65879777-65879799 TTGAATGAAATACTGCAGAAGGG - Intergenic
1042956543 8:74257208-74257230 ATGAATACATCACAGTAGCATGG - Intronic
1044576307 8:93773409-93773431 TTGAAAGGATCATTGTAGCATGG + Intronic
1044683255 8:94802698-94802720 CTGATTGCACCACTGCAGCTTGG - Intergenic
1044855106 8:96467715-96467737 GAGATTGCACCACTGCAGCATGG - Intergenic
1045695208 8:104801499-104801521 TAGAATGCATAACTGAAGGAGGG - Intronic
1050904912 9:10992135-10992157 TTTCATGCATGAATGCAGCAAGG - Intergenic
1052620919 9:30909132-30909154 TTCAATGCATCTTGGCAGCATGG + Intergenic
1054902505 9:70383873-70383895 ATGCCTGCATCACAGCAGCAAGG - Intergenic
1054934495 9:70672217-70672239 CTGAATTCATCACTGTGGCAGGG - Intronic
1055582225 9:77718408-77718430 TTCTATGCATCACTGCTGCTAGG + Exonic
1057929728 9:99183399-99183421 TTCCATGCAATACTGCAGCAAGG + Intergenic
1059879578 9:118675370-118675392 TTGAACGTTTCACTGAAGCATGG - Intergenic
1062340232 9:136090846-136090868 TGGGAGGCATCTCTGCAGCATGG + Intronic
1186882654 X:13881461-13881483 ATGATTGCATCACTGCACCCCGG + Intronic
1186882759 X:13882629-13882651 ATGATTGCATCACTGCACCCCGG + Intronic
1187011899 X:15288010-15288032 TGGACTGCCTCGCTGCAGCATGG + Exonic
1189365261 X:40383265-40383287 TTGAATGGATGCCTGGAGCAGGG - Intergenic
1191207697 X:57851800-57851822 GTGGATGCAGCACAGCAGCATGG + Intergenic
1191816334 X:65250016-65250038 ATGAATGCAGCACACCAGCATGG - Intergenic
1201644694 Y:16217502-16217524 CTGAATGAAACATTGCAGCAAGG - Intergenic
1201658121 Y:16367820-16367842 CTGAATGAAACATTGCAGCAAGG + Intergenic