ID: 913439782

View in Genome Browser
Species Human (GRCh38)
Location 1:118885184-118885206
Sequence GAGTTGGTATTCCTGAGATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 333}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913439772_913439782 28 Left 913439772 1:118885133-118885155 CCAGCTGGCCACCGTAGGCTTCC 0: 1
1: 0
2: 0
3: 19
4: 132
Right 913439782 1:118885184-118885206 GAGTTGGTATTCCTGAGATCAGG 0: 1
1: 0
2: 0
3: 15
4: 333
913439770_913439782 30 Left 913439770 1:118885131-118885153 CCCCAGCTGGCCACCGTAGGCTT 0: 1
1: 0
2: 0
3: 6
4: 115
Right 913439782 1:118885184-118885206 GAGTTGGTATTCCTGAGATCAGG 0: 1
1: 0
2: 0
3: 15
4: 333
913439774_913439782 17 Left 913439774 1:118885144-118885166 CCGTAGGCTTCCATCTTGCTGTT 0: 1
1: 1
2: 2
3: 29
4: 284
Right 913439782 1:118885184-118885206 GAGTTGGTATTCCTGAGATCAGG 0: 1
1: 0
2: 0
3: 15
4: 333
913439776_913439782 7 Left 913439776 1:118885154-118885176 CCATCTTGCTGTTGCCAGGCAAC 0: 1
1: 0
2: 2
3: 16
4: 204
Right 913439782 1:118885184-118885206 GAGTTGGTATTCCTGAGATCAGG 0: 1
1: 0
2: 0
3: 15
4: 333
913439773_913439782 20 Left 913439773 1:118885141-118885163 CCACCGTAGGCTTCCATCTTGCT 0: 1
1: 0
2: 1
3: 11
4: 153
Right 913439782 1:118885184-118885206 GAGTTGGTATTCCTGAGATCAGG 0: 1
1: 0
2: 0
3: 15
4: 333
913439780_913439782 -7 Left 913439780 1:118885168-118885190 CCAGGCAACGAGGGAGGAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 171
Right 913439782 1:118885184-118885206 GAGTTGGTATTCCTGAGATCAGG 0: 1
1: 0
2: 0
3: 15
4: 333
913439771_913439782 29 Left 913439771 1:118885132-118885154 CCCAGCTGGCCACCGTAGGCTTC 0: 1
1: 0
2: 1
3: 6
4: 96
Right 913439782 1:118885184-118885206 GAGTTGGTATTCCTGAGATCAGG 0: 1
1: 0
2: 0
3: 15
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913439782 Original CRISPR GAGTTGGTATTCCTGAGATC AGG Exonic
902130387 1:14255236-14255258 GAGTGAGTTTTCATGAGATCTGG - Intergenic
904510531 1:31002515-31002537 CAGCTGGTATTCCAGAGAGCAGG + Intronic
906287254 1:44595400-44595422 AAGCTGGCATTCCTGAGTTCTGG + Intronic
906889687 1:49695533-49695555 GAGAGGGTTTTCCTAAGATCAGG + Intronic
907790988 1:57663225-57663247 GAGTGAGTTTGCCTGAGATCTGG - Intronic
909805768 1:79872733-79872755 GAGTAAGTTTTCATGAGATCTGG + Intergenic
909900521 1:81129012-81129034 GAGTGCGTTTTCTTGAGATCTGG + Intergenic
910217311 1:84855381-84855403 GAGAGGGTGTTCCTGAGTTCTGG + Intronic
910222126 1:84898363-84898385 GAGCTGATATTGCTGATATCAGG - Intergenic
910481504 1:87663127-87663149 GAGTGGGTCCTCATGAGATCTGG + Intergenic
911540490 1:99151783-99151805 GAGTTAGTTCTCATGAGATCTGG - Intergenic
911696111 1:100892207-100892229 GAGTGGGTCTTCCTGAGAGTGGG - Intronic
912628631 1:111227567-111227589 GAGTTGGCATTGCTCAAATCTGG + Intronic
912941886 1:114052504-114052526 GAGTTGGAATTCCTGCAATTGGG - Intergenic
913439782 1:118885184-118885206 GAGTTGGTATTCCTGAGATCAGG + Exonic
913526713 1:119700693-119700715 GAATTAGTTTTCATGAGATCTGG + Intronic
913616072 1:120560214-120560236 GAGTGAGTTTTTCTGAGATCTGG + Intergenic
914574204 1:148950684-148950706 GAGTGAGTTTTTCTGAGATCTGG - Intronic
914857559 1:151363609-151363631 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
916374648 1:164139088-164139110 GAGTTGGTATTGCAGAGACATGG + Intergenic
917370717 1:174290542-174290564 TAGTTGGTATTTCTGTGATGGGG + Intronic
917573779 1:176297726-176297748 GAGCTAGTTTTCATGAGATCTGG + Intergenic
919468459 1:197950155-197950177 GAGTGAGTTTTCATGAGATCTGG - Intergenic
919829580 1:201531162-201531184 GAGTTGGCATTGCTGATGTCTGG - Intergenic
920642646 1:207768706-207768728 GAGATGGTAGTGCTGAAATCAGG - Intronic
920898059 1:210077275-210077297 GAGTGAGTACTCCTGAGACCTGG - Intronic
922145562 1:222940351-222940373 GAGTGGGTTCTCCTGAGATCTGG - Intronic
922360565 1:224817833-224817855 GACTTGGGATTCTTGAGAACAGG + Intergenic
923583858 1:235247759-235247781 CAGGTGGAATACCTGAGATCGGG + Intronic
1063733451 10:8724898-8724920 GAGTGAGTTATCCTGAGATCTGG + Intergenic
1064199218 10:13270640-13270662 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
1065050457 10:21786700-21786722 GAGGTGGATCTCCTGAGATCAGG - Intronic
1065550318 10:26863083-26863105 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
1065785011 10:29204694-29204716 GATTTGGTATTTCAGAAATCAGG - Intergenic
1066128126 10:32362408-32362430 GAGTGAGTTTTCATGAGATCTGG + Intronic
1066342050 10:34544654-34544676 GAGTTGGTATTACAGATTTCTGG - Intronic
1066529804 10:36324956-36324978 GAGTTGGTCTTGCTGAGTTGAGG - Intergenic
1067798586 10:49339915-49339937 GAGTGAGTACTCATGAGATCTGG + Intergenic
1072486257 10:95858658-95858680 GTGCTGGAATTCCTGAGTTCAGG + Intronic
1073464234 10:103684576-103684598 CAGTTGGATCTCCTGAGATCAGG - Intronic
1074474997 10:113764325-113764347 GTGGTGGATTTCCTGAGATCAGG - Intronic
1075431065 10:122381457-122381479 GAGTGAGTTCTCCTGAGATCTGG + Intronic
1076541376 10:131217207-131217229 GAGTGAGTTTTCCTGAGATCTGG + Intronic
1078223187 11:9368922-9368944 TATTTGGTATACCTAAGATCAGG + Intergenic
1078724045 11:13912601-13912623 GAGTGAGTTATCCTGAGATCTGG + Intergenic
1078936646 11:15957205-15957227 GAGTTCGTTCTCATGAGATCTGG - Intergenic
1079328496 11:19514525-19514547 GAGTTGGTCTCTCTGAGATGCGG - Intronic
1079538236 11:21540690-21540712 GAGTGGGTTCTCATGAGATCTGG - Intronic
1079834041 11:25308739-25308761 GAGTGGGTTCTCATGAGATCTGG + Intergenic
1081714726 11:45241576-45241598 GAGTTGATAATTCTGGGATCGGG + Exonic
1081752836 11:45524383-45524405 GAGTGAGTTTTCATGAGATCTGG - Intergenic
1082744693 11:56949112-56949134 TAGTTTGCATTCCTGAGATATGG + Intergenic
1083180932 11:60984766-60984788 GAGCTGGGAATGCTGAGATCAGG + Intronic
1084414572 11:69023952-69023974 GAGTTGGTAGACCTGAGGTAAGG + Intergenic
1084594568 11:70109310-70109332 GAACTGGAATTCCTGAGGTCAGG + Intronic
1084669208 11:70595424-70595446 GAGTTTTTATCCCTGAGATGAGG + Intronic
1084788994 11:71461747-71461769 GAGTGGGTTCTCATGAGATCTGG - Intronic
1086564566 11:88211391-88211413 GAGTGAGTTTTCCTGATATCTGG - Intergenic
1087463742 11:98477816-98477838 GAGTTCGTTCTCATGAGATCTGG - Intergenic
1087641271 11:100756746-100756768 CAGTTGGAATTCCTCAGTTCTGG + Intronic
1088026901 11:105196589-105196611 GAGTTGGCATTTTTGAGATTTGG - Intergenic
1089477290 11:118774998-118775020 TAGTTGCTATTTCTGAGATTTGG - Intronic
1091474168 12:754715-754737 GTGTTTTCATTCCTGAGATCAGG + Intronic
1091760774 12:3085752-3085774 GAGTTGGTATGCCTGGGTTTTGG + Intronic
1092876028 12:12848798-12848820 GAGTTAGTTCTCATGAGATCTGG + Intergenic
1095216515 12:39556420-39556442 GAGTGAGTTTTCATGAGATCTGG + Intronic
1095226595 12:39685447-39685469 GAGTTTGTTCTCCTGTGATCTGG - Intronic
1097401491 12:59133938-59133960 GAGTGAGTTTTCATGAGATCTGG - Intergenic
1097901512 12:64878037-64878059 GGGTTGGTCTTCCTGAGAAGGGG + Intronic
1099626728 12:85085328-85085350 GAGTGAGTTTTCATGAGATCTGG - Intronic
1099830254 12:87833079-87833101 GAGTGAGTTTTCATGAGATCTGG + Intergenic
1101526040 12:105531923-105531945 GAGTAAGTTTTCATGAGATCTGG - Intergenic
1102340944 12:112121232-112121254 GAGGTGGAACACCTGAGATCAGG + Intergenic
1105694566 13:22875072-22875094 GACTTGTTTTTCCTGAAATCAGG + Intergenic
1108612280 13:52095985-52096007 GAGTGAGTTTTCATGAGATCTGG + Intronic
1108627271 13:52243014-52243036 GAGGTGGTTTACCTGAGGTCAGG - Intergenic
1108658796 13:52563450-52563472 GAGGTGGTTTACCTGAGGTCAGG + Intergenic
1111140683 13:84114148-84114170 AAATTGCCATTCCTGAGATCTGG - Intergenic
1111296926 13:86291182-86291204 GAGTGAGTTTTCATGAGATCTGG + Intergenic
1111515911 13:89330658-89330680 GAGTGAGTTTTCATGAGATCTGG - Intergenic
1111989377 13:95101778-95101800 GAGTTTGTATTCCAGATATTAGG - Intronic
1112240450 13:97676540-97676562 TAGTTGGTAAGCCTGAGATCAGG + Intergenic
1112961859 13:105136617-105136639 GAGTGGGTGTTACTGAGATATGG - Intergenic
1113907919 13:113828904-113828926 CAGGTGGTCTCCCTGAGATCGGG - Intronic
1113907946 13:113828996-113829018 CAGGTGGTCTCCCTGAGATCGGG - Intronic
1113907996 13:113829180-113829202 CAGGTGGTCTCCCTGAGATCGGG - Intronic
1116581035 14:46641820-46641842 GAGTGAGTACTCATGAGATCTGG + Intergenic
1119235731 14:73017712-73017734 GATTTGGTGTTACTGAGATGGGG - Intronic
1119691629 14:76677441-76677463 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
1121961265 14:98262422-98262444 GAGTGAGTTCTCCTGAGATCGGG - Intergenic
1122279637 14:100613858-100613880 GGGTTGGATTTCCTGAGCTCAGG - Intergenic
1123800530 15:23815203-23815225 GAGTTCTCATTTCTGAGATCAGG - Intergenic
1126001167 15:44211232-44211254 GAGTTCAGATTTCTGAGATCTGG + Intergenic
1126282098 15:46965358-46965380 GAGTAAGTACTCATGAGATCTGG + Intergenic
1127332777 15:57955109-57955131 AACTTTGTATTCCTGAGAGCTGG + Exonic
1127710144 15:61589133-61589155 GAGTTCGTTCTCATGAGATCTGG - Intergenic
1128587934 15:68867430-68867452 GAGGTGGTATCTGTGAGATCAGG - Intronic
1129923680 15:79342958-79342980 GAATAGGTATTACTGAGATTGGG + Intronic
1131199090 15:90381300-90381322 GAGTGAGTTTTCATGAGATCTGG - Intergenic
1131404222 15:92150626-92150648 ATGTTGGTTTTGCTGAGATCAGG - Intronic
1131622034 15:94078528-94078550 GAGTGGGTTCTCATGAGATCTGG + Intergenic
1131740942 15:95390630-95390652 GAGTTGGTATACTTGAGAAAGGG + Intergenic
1132920904 16:2391773-2391795 GTGTTGGTATTTCTGAGCCCAGG - Intergenic
1133442338 16:5831266-5831288 GAGTGAGTTTTCCAGAGATCTGG + Intergenic
1134424982 16:14132763-14132785 GAGTTGGTAATCCAGAAAGCTGG - Intronic
1134753190 16:16642741-16642763 GAGTGAGTTTTCATGAGATCTGG - Intergenic
1134992867 16:18716343-18716365 GAGTGAGTTTTCATGAGATCTGG + Intergenic
1135334079 16:21586214-21586236 GAGTTGGAACTCCTGACCTCAGG - Intergenic
1135472465 16:22743577-22743599 GAGTGAGTACTCATGAGATCTGG - Intergenic
1138860550 16:60750800-60750822 GAGTTAGTTCTCATGAGATCTGG - Intergenic
1140052870 16:71498250-71498272 GAGTGAGTCTTCCTGAGATCTGG + Intronic
1140775844 16:78248325-78248347 GAGTTGGCTCTCCTGAGATCTGG - Intronic
1141285491 16:82668053-82668075 TACTTGGTATTCATGACATCAGG - Intronic
1143060742 17:4198597-4198619 CAGGTGGTTTTCCTGAGCTCAGG - Intronic
1143593558 17:7900487-7900509 GAGGTGGTAAGTCTGAGATCAGG + Intronic
1144359625 17:14479555-14479577 GAGCTGCTTTTCCTGAGCTCTGG - Intergenic
1146538814 17:33676925-33676947 GAGTGAGTTCTCCTGAGATCTGG + Intronic
1152004627 17:77672324-77672346 GAGCTGGGCTTCCTGAGATGGGG - Intergenic
1153338273 18:3947519-3947541 GAGTTGGTCTGACTGAGAACTGG - Intronic
1153440714 18:5116423-5116445 GAGTGAGTTTTCATGAGATCTGG + Intergenic
1155707699 18:28837346-28837368 GAGTGAGTACTCATGAGATCTGG - Intergenic
1156072581 18:33230723-33230745 GAGATGTTTTTCCTGAGATGTGG + Intronic
1158918628 18:62164540-62164562 GAGTGGGTTCTCGTGAGATCTGG - Intronic
1162639889 19:11999982-12000004 GAGATGGTCTTCCTGGGAGCTGG - Intergenic
1164749146 19:30638519-30638541 GAGTAAGTTATCCTGAGATCTGG - Intronic
1167985005 19:53307201-53307223 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
925096876 2:1212215-1212237 GAGTGGGTTCTCCTGATATCTGG + Intronic
926704400 2:15826526-15826548 GGTGTGGTATTCCTGAGCTCAGG - Intergenic
926950947 2:18242809-18242831 GAGTGGGTTCTCATGAGATCTGG + Intronic
927045653 2:19275586-19275608 CTGTTGGTATTCCTCACATCTGG - Intergenic
928613671 2:33015885-33015907 GAGTGGGTGATTCTGAGATCTGG - Intronic
930174581 2:48288691-48288713 GAGTGAGTTTTCATGAGATCTGG + Intergenic
931900217 2:66780127-66780149 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
931995638 2:67836872-67836894 GACTGGGTATTCATTAGATCTGG - Intergenic
932127435 2:69156714-69156736 TAGTGAGTTTTCCTGAGATCCGG - Intronic
933164969 2:79065737-79065759 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
933458055 2:82542100-82542122 GAGTAAGTTCTCCTGAGATCTGG - Intergenic
933850780 2:86364899-86364921 GAGTGAGTTTTCATGAGATCTGG - Intergenic
934539627 2:95163085-95163107 TAGTGAGTACTCCTGAGATCTGG - Intronic
934926559 2:98385886-98385908 GAGTGAGTTTTCTTGAGATCTGG - Intronic
935564292 2:104590084-104590106 GAGGTGGTATGCATGTGATCAGG - Intergenic
936677358 2:114730815-114730837 CAGTTGGATTGCCTGAGATCAGG - Intronic
937948070 2:127359710-127359732 CTGGTGGTGTTCCTGAGATCTGG + Intronic
938027394 2:127961861-127961883 GAGGAGGTATTTCTGAGCTCTGG + Intronic
939511903 2:143117414-143117436 GAGTGAGTTTTCATGAGATCTGG - Intronic
939959309 2:148552241-148552263 GAGTGAGTATTCCTGAGACAGGG - Intergenic
940086134 2:149861244-149861266 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
940691825 2:156927927-156927949 GAGTAAGTTTTCATGAGATCTGG - Intergenic
941539522 2:166765244-166765266 GGGTTGTCATTTCTGAGATCAGG + Intergenic
942088359 2:172463865-172463887 TTGTTGGCATTCCTGGGATCGGG + Intronic
942347308 2:175016936-175016958 CAGTTAGTTTACCTGAGATCTGG + Intergenic
942769971 2:179504828-179504850 GAGTGAGTTCTCCTGAGATCTGG - Intronic
942991324 2:182206794-182206816 GAGTTAGTTCTCATGAGATCTGG + Intronic
943124892 2:183783614-183783636 CAGTGGGTTTTCATGAGATCTGG + Intergenic
943491546 2:188560837-188560859 GAGTAGGTTCTCATGAGATCTGG - Intronic
944266081 2:197728748-197728770 GAGCAGGTTTTCCTGAGTTCTGG - Intronic
945328663 2:208514468-208514490 GAGTAGGTTATCATGAGATCTGG - Intronic
946110842 2:217414650-217414672 GAGTAAGTTCTCCTGAGATCTGG - Intronic
946126332 2:217566269-217566291 GAGTGAGTTCTCCTGAGATCTGG - Intronic
946619991 2:221550702-221550724 CAGTTGGTATTCCAAAGTTCTGG + Intronic
947101933 2:226630443-226630465 GAGTCAGTATTCCTGTGATATGG + Intergenic
948321621 2:237074214-237074236 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
1170090953 20:12589348-12589370 GAGTGAGTTATCCTGAGATCTGG - Intergenic
1170096195 20:12648385-12648407 GGGTTGGTATTCCAGTTATCAGG - Intergenic
1170886990 20:20348910-20348932 GAATTCTTATCCCTGAGATCTGG + Intronic
1171351983 20:24509950-24509972 GAGTGAGTTCTCCTGAGATCTGG + Intronic
1172928544 20:38563953-38563975 GAGTAGGGAGTTCTGAGATCTGG - Intronic
1176914418 21:14608083-14608105 AAGTTGGTATTCCTGTGAGAGGG - Intronic
1177259234 21:18707208-18707230 CAGGTGGTATGCCTGAGCTCAGG - Intergenic
1179544103 21:42103001-42103023 GAGTTGGGGTTCCTCAGCTCAGG - Exonic
1181322538 22:22019444-22019466 AAGTTGTTATTCCTAAGATCAGG - Intergenic
1183711938 22:39509923-39509945 GAGTGGGGAGTCCTGAGTTCTGG + Intronic
1183750414 22:39716795-39716817 GAGTTCCAATTCCTGAGTTCCGG - Intergenic
1183886206 22:40884796-40884818 GAGGTGGATTGCCTGAGATCAGG + Intronic
1184397860 22:44255405-44255427 GAGTTGTATTTCCTGAGGTCAGG - Intronic
949108080 3:224481-224503 GAGTGAGTACTCATGAGATCTGG + Intronic
949231688 3:1757392-1757414 GAGCTGGTACTCCAGACATCTGG - Intergenic
951034834 3:17921517-17921539 GAGTGAGTTTTCATGAGATCTGG + Intronic
951673217 3:25208064-25208086 GAGTGAGTACTCATGAGATCCGG - Intronic
951972138 3:28458587-28458609 GAGTTTGTAATCATAAGATCTGG - Intronic
952019584 3:29001324-29001346 GAGTGGGTACTTCTGAGATTAGG + Intergenic
952479496 3:33746551-33746573 GAGTGTGTACTCCTGAGGTCTGG + Intergenic
954777265 3:53031090-53031112 GAGTTGGGATCCCTGAAACCAGG - Intronic
955069775 3:55562378-55562400 GAGTTGGAACACCTGAGATCAGG - Intronic
959349889 3:105249009-105249031 GAGTGGGTTCTCATGAGATCTGG + Intergenic
959999265 3:112713758-112713780 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
960082000 3:113551954-113551976 GAAGTGTTATTCCTGAGAACTGG + Intronic
961397309 3:126604314-126604336 GAGTTGGTGATCCTGAGCTGTGG - Intronic
961654079 3:128432164-128432186 GAGGTGGCAGTCGTGAGATCAGG + Intergenic
961883181 3:130077504-130077526 GAGTGGGTTCTCATGAGATCTGG + Intergenic
962333994 3:134509314-134509336 TAGTGAGTTTTCCTGAGATCTGG - Intronic
962716228 3:138128507-138128529 GAGTGGGTTCTCGTGAGATCTGG - Intronic
963963634 3:151339689-151339711 GAGTTGGCATTCCTCAAAACAGG + Intronic
964061020 3:152522844-152522866 GAGTGAGTTTTCATGAGATCTGG - Intergenic
964284304 3:155101036-155101058 GAGTGAGTTTTCATGAGATCTGG + Intronic
965805350 3:172536227-172536249 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
966260361 3:177970526-177970548 AATTTAGTATTCCTGAGATAGGG - Intergenic
966766989 3:183472340-183472362 GAGTGGGTTCTCGTGAGATCTGG + Intergenic
966877972 3:184334411-184334433 GAATTGGTACTCCTGAATTCAGG - Intronic
966938491 3:184730224-184730246 GAGCTGGTGTTCCTCAGACCAGG - Intergenic
967070954 3:185961808-185961830 GAGTTCGTTCTCATGAGATCTGG + Intergenic
967812096 3:193769055-193769077 GAGTGAGTAATCTTGAGATCTGG + Intergenic
967921569 3:194617859-194617881 GAGTGAGTTCTCCTGAGATCTGG + Intronic
968128565 3:196178173-196178195 GAGTTGTTATTGCTCTGATCTGG - Intergenic
968235414 3:197028077-197028099 GGGCTGGTATTCCTGTGCTCAGG + Intronic
970738906 4:19209620-19209642 GAGTGAGTTTTCATGAGATCTGG - Intergenic
970762479 4:19507730-19507752 GAGTTGGCAATCATGAGATACGG - Intergenic
971011737 4:22445422-22445444 GATTTGGTATTCCAGAACTCTGG - Intronic
971031640 4:22643728-22643750 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
972186948 4:36541023-36541045 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
972367658 4:38391464-38391486 GAGTGAGTTTTCATGAGATCTGG + Intergenic
972657108 4:41074930-41074952 GTGTTGGAATTCCTGGGCTCAGG - Intronic
972754535 4:42032115-42032137 GAGTTCGTTCTCATGAGATCTGG - Intronic
972844542 4:42971602-42971624 GAGTGAGTTCTCCTGAGATCTGG - Intronic
972911689 4:43824240-43824262 GAGTGAGTTTTCATGAGATCTGG - Intergenic
973811488 4:54574688-54574710 GATTGAGTTTTCCTGAGATCTGG + Intergenic
974324015 4:60390512-60390534 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
974746515 4:66084830-66084852 GAGTGAGTTTTCATGAGATCTGG + Intergenic
975142525 4:70933192-70933214 GATTTTGTTCTCCTGAGATCTGG - Intronic
976458724 4:85282619-85282641 GATTTGGTATTCATTAGATCTGG + Intergenic
976870716 4:89790176-89790198 GAGATGGTTTTCCTGAGATAAGG - Intronic
976916358 4:90379976-90379998 GAGTGAGTTCTCCTGAGATCTGG - Intronic
978251591 4:106637481-106637503 GAGTGAGTTTTCATGAGATCTGG + Intergenic
978739111 4:112117844-112117866 GATCTGGAATTCCTGAGCTCAGG - Intergenic
979420628 4:120501570-120501592 GAGTTAGTTCTCATGAGATCTGG - Intergenic
979714388 4:123819520-123819542 AATTTGGTAAGCCTGAGATCAGG - Intergenic
979897930 4:126184202-126184224 GTGTTGTTATTCATGACATCAGG + Intergenic
980453769 4:133012275-133012297 GTGTTGGTAATCCTGGAATCTGG - Intergenic
980710173 4:136556087-136556109 AAGTGGGTATTCTTGACATCAGG - Intergenic
984088429 4:175340689-175340711 GAGTTGCCATTACTGAGATGGGG - Intergenic
985196269 4:187432847-187432869 GATGTGGTATTCCTGAGAGCAGG + Intergenic
985804155 5:2028256-2028278 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
986156653 5:5183294-5183316 GAGTTGGGAATCCTGAGGTTGGG + Intronic
987861848 5:23499602-23499624 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
988370927 5:30365995-30366017 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
988756278 5:34254810-34254832 GAGTGAGTTTTCATGAGATCTGG + Intergenic
989499638 5:42150327-42150349 GAGTGGGTTCTCATGAGATCTGG + Intergenic
991450371 5:66744684-66744706 GAGTGAGTTATCCTGAGATCTGG - Intronic
992208764 5:74456764-74456786 GAGTGGGTTCTCATGAGATCTGG - Intergenic
992265904 5:75018018-75018040 GATTTGGTATTTCTGGGATTGGG - Intergenic
992372845 5:76162814-76162836 CAGTCGGTAGTCCTGAGAGCAGG + Intronic
993253010 5:85552832-85552854 GAGTGAGTTTTCATGAGATCTGG - Intergenic
993753137 5:91695009-91695031 GAGTGAGTACTCATGAGATCTGG - Intergenic
994697024 5:103085017-103085039 GAGCTGTTATTCCAGAGATGGGG + Intergenic
996707310 5:126510734-126510756 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
998461307 5:142312139-142312161 GAGATGGTTTTCCTCAGATGAGG - Exonic
999563668 5:152833603-152833625 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
1000548718 5:162633300-162633322 GAGTGAGTTTTCATGAGATCTGG - Intergenic
1000567468 5:162867625-162867647 CAGTGGGTTATCCTGAGATCTGG + Intergenic
1001342182 5:170857861-170857883 GATTTGTTATTTCTAAGATCAGG - Intergenic
1001477631 5:172061906-172061928 GAGGTGATATTACTGAGATTAGG + Intronic
1003809737 6:9766738-9766760 GAGTTAGTTCTCATGAGATCTGG - Intronic
1004047529 6:12040912-12040934 GAGTGAGTTCTCCTGAGATCTGG - Intronic
1005074466 6:21892937-21892959 GAGTTGAGATTTCTGAGTTCTGG - Intergenic
1005534239 6:26738506-26738528 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
1005536556 6:26763148-26763170 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
1007557338 6:42777560-42777582 GTGTTGGTATTTCTGTGATCTGG + Intronic
1008098575 6:47366804-47366826 GAGTTAGTGATCATGAGATCTGG - Intergenic
1008236387 6:49056974-49056996 GAGTGAGTTTTCATGAGATCTGG - Intergenic
1009007456 6:57805562-57805584 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
1009567879 6:65335958-65335980 GAGTGAGTTCTCCTGAGATCTGG + Intronic
1011331010 6:86206495-86206517 GAGTAGGAATTTATGAGATCAGG - Intergenic
1015788358 6:136941377-136941399 GAGTGAGTTATCCTGAGATCTGG + Intergenic
1017108656 6:150912041-150912063 GAGTGAGTTATCCTGAGATCTGG - Intronic
1017371187 6:153711034-153711056 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
1017906905 6:158762986-158763008 GAGTTGATTTTCCTGAGAACAGG + Intronic
1018102614 6:160454545-160454567 GATTCTGTGTTCCTGAGATCTGG + Intergenic
1018570371 6:165203773-165203795 GAGTGAGTGTTCATGAGATCTGG + Intergenic
1020224203 7:6267037-6267059 GAGTGAGGACTCCTGAGATCTGG + Intronic
1020541924 7:9469478-9469500 GAGTGAGTTTTCATGAGATCTGG + Intergenic
1020769956 7:12378421-12378443 GAGTTGAACTTCCTGAGAACTGG + Intronic
1020981075 7:15069844-15069866 GAGTGAGTTTTCATGAGATCTGG - Intergenic
1023603183 7:41900994-41901016 AAGTTGGTGTTGCTGAGTTCTGG + Intergenic
1023709647 7:42977875-42977897 GAGTGGGTTCTCATGAGATCTGG + Intergenic
1024167714 7:46751058-46751080 GGGGTGGTATTCCAGAGAGCAGG - Intronic
1026115268 7:67490571-67490593 GAGTGAGTTTTCATGAGATCTGG + Intergenic
1026165247 7:67903673-67903695 GAGGTGGATTACCTGAGATCAGG + Intergenic
1026257489 7:68725272-68725294 GAGTGAGTTGTCCTGAGATCTGG - Intergenic
1030209369 7:106981188-106981210 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
1030695206 7:112577681-112577703 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
1031717491 7:125126438-125126460 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
1031771211 7:125846947-125846969 GAGTGAGTTTTCATGAGATCTGG + Intergenic
1032305071 7:130725364-130725386 GAGTTGGCATTCATGTAATCAGG - Intergenic
1033104708 7:138510647-138510669 CAGGTGGTATGCCTGAGCTCAGG - Intronic
1033497892 7:141917907-141917929 GAGCTGGTATCCCAGAGGTCAGG + Intronic
1034728997 7:153367027-153367049 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
1035057543 7:156046146-156046168 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
1035663955 8:1366492-1366514 GAGTTGGTCTTCCTGAGCTGAGG + Intergenic
1035809233 8:2476591-2476613 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
1037731978 8:21533776-21533798 GAGTGGGTTCTCCTGAGATCTGG - Intergenic
1037973047 8:23188389-23188411 GAGTGAGTTGTCCTGAGATCTGG + Intergenic
1038048303 8:23785930-23785952 GAGTTGGAATTCCTGGGGTGGGG + Intergenic
1038104425 8:24416466-24416488 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
1038942474 8:32320590-32320612 GAGTGAGTTCTCCTGAGATCTGG - Intronic
1039091719 8:33836672-33836694 GAGTATGTTTTCATGAGATCTGG + Intergenic
1039137529 8:34342318-34342340 GAGTGGGTTTTCATGATATCTGG + Intergenic
1039148554 8:34478293-34478315 GAGTGGGTGTTTATGAGATCTGG - Intergenic
1039258192 8:35741856-35741878 GACTTGGTATTTCTGGGATAGGG - Intronic
1039648707 8:39316516-39316538 GAGTTGGCATTACTGATCTCAGG - Intergenic
1040813221 8:51480444-51480466 GAGTGTGTTTTCTTGAGATCTGG - Intronic
1040863587 8:52025067-52025089 GAGTATGTTCTCCTGAGATCTGG + Intergenic
1043097613 8:75995407-75995429 GAGTTAGTTTTCCTGAAAGCAGG - Intergenic
1043362552 8:79492383-79492405 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
1043714442 8:83464145-83464167 GAGTTAGTATCCCTGAAATGTGG - Intergenic
1044044177 8:87409804-87409826 GGTCTGGAATTCCTGAGATCTGG - Intronic
1044157204 8:88862396-88862418 GAGTGAGTTCTCCTGAGATCTGG - Intergenic
1044813907 8:96091074-96091096 AAGTTTGGATTCCTGTGATCTGG + Intergenic
1044896654 8:96899642-96899664 GAGTGAGTTTTCATGAGATCTGG - Intronic
1045887247 8:107113285-107113307 GAGTGAGTACTCATGAGATCTGG - Intergenic
1045952106 8:107864213-107864235 GAGTGAGTTTTCATGAGATCTGG - Intergenic
1046273493 8:111926149-111926171 GAGTGAGTGGTCCTGAGATCTGG - Intergenic
1046314061 8:112477561-112477583 GAGTGTGTTCTCCTGAGATCTGG + Intronic
1049550420 8:143255431-143255453 GTGCTGGTGTTCTTGAGATCAGG + Intronic
1049550441 8:143255566-143255588 GTGCTGGTGTTCTTGAGATCAGG + Intronic
1049550484 8:143255837-143255859 GTGCTGGTGTTCTTGAGATCAGG + Intronic
1049550518 8:143256041-143256063 GTGCTGGTGTTCTTGAGATCAGG + Intronic
1050396555 9:5204208-5204230 GAGTGAGTTTTCATGAGATCTGG - Intergenic
1050770908 9:9198586-9198608 GGTTTGGAATTCCTGAGATTTGG + Intronic
1051306137 9:15712003-15712025 GAGTTTGAAGTCCTGAGAACTGG + Intronic
1051677450 9:19572471-19572493 GAGTGGGTTCTCATGAGATCTGG + Intronic
1052738695 9:32372635-32372657 GAGCTGCTATTCATGACATCAGG + Intergenic
1053193480 9:36095707-36095729 CAGTTGGAATGCCTGAGCTCAGG + Intronic
1053234653 9:36442118-36442140 GAGTTGGTAGTGATGAGATTAGG - Intronic
1053300031 9:36942314-36942336 GTGTTGCTTTTCCTGAGACCTGG - Intronic
1055522184 9:77092814-77092836 GAGTTTGTTTTCCAGAGAGCTGG + Intergenic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1057982979 9:99681047-99681069 GAGTGAGTAATCATGAGATCTGG - Intergenic
1058668350 9:107340535-107340557 GAGTTTGTTTTCCTGAAAGCAGG - Intergenic
1059140280 9:111846793-111846815 GTGTTTGTGGTCCTGAGATCTGG - Intergenic
1059681746 9:116592401-116592423 GAGTGAGTTATCCTGAGATCTGG - Intronic
1059695335 9:116725200-116725222 GAATTGGAATTCCTCAGACCAGG - Intronic
1060203051 9:121663379-121663401 GAGCTGGTATTCCAGAGGTGGGG - Intronic
1061080649 9:128367806-128367828 GTAGTGGTATTCCTGAGATGGGG + Intergenic
1188384510 X:29539636-29539658 GAGTGGGTTTTCAGGAGATCTGG + Intronic
1188607123 X:32045060-32045082 GAGTGAGTTTTCATGAGATCTGG + Intronic
1189988315 X:46573368-46573390 GAGTGGGTGTTACTGAGTTCCGG - Intergenic
1193498841 X:82247357-82247379 GAGTGAGTTTTCATGAGATCTGG + Intergenic
1193840553 X:86404001-86404023 GAGTGAGTTTTCATGAGATCTGG - Intronic
1194329396 X:92562191-92562213 GAGTGAGTTCTCCTGAGATCTGG - Intronic
1194924919 X:99813434-99813456 GAGTTGTTTTTGCTGAGAACAGG + Intergenic
1195815786 X:108885813-108885835 GAGTGAGTTTTCATGAGATCTGG + Intergenic
1196541358 X:116912223-116912245 GAGTGAGTTCTCCTGAGATCTGG + Intergenic
1197115320 X:122825169-122825191 GAGTTGGTATGACTGAGAGAAGG - Intergenic
1197375861 X:125681513-125681535 AATTTGGTATTCCTGTGATGGGG - Intergenic
1199091672 X:143700672-143700694 GAGTGAGTACTCATGAGATCTGG + Intergenic
1199223382 X:145343220-145343242 GAGTGAGTTTTCATGAGATCTGG - Intergenic
1199300994 X:146213808-146213830 GAGTTAGTTTTCATGAGATCTGG + Intergenic
1200638095 Y:5681381-5681403 GAGTGAGTTCTCCTGAGATCTGG - Intronic
1200811846 Y:7494102-7494124 CAGTTGGATTTCCTGAGGTCAGG + Intergenic