ID: 913440242

View in Genome Browser
Species Human (GRCh38)
Location 1:118889366-118889388
Sequence TTGTAAATGATCAAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913440242_913440250 27 Left 913440242 1:118889366-118889388 CCATCCTCTTTGATCATTTACAA No data
Right 913440250 1:118889416-118889438 CAGAAAAGCTAGGGCAGGGTGGG 0: 1
1: 0
2: 0
3: 44
4: 330
913440242_913440249 26 Left 913440242 1:118889366-118889388 CCATCCTCTTTGATCATTTACAA No data
Right 913440249 1:118889415-118889437 ACAGAAAAGCTAGGGCAGGGTGG 0: 1
1: 0
2: 1
3: 35
4: 436
913440242_913440245 17 Left 913440242 1:118889366-118889388 CCATCCTCTTTGATCATTTACAA No data
Right 913440245 1:118889406-118889428 ATTCTCATCACAGAAAAGCTAGG 0: 1
1: 0
2: 1
3: 23
4: 509
913440242_913440246 18 Left 913440242 1:118889366-118889388 CCATCCTCTTTGATCATTTACAA No data
Right 913440246 1:118889407-118889429 TTCTCATCACAGAAAAGCTAGGG No data
913440242_913440248 23 Left 913440242 1:118889366-118889388 CCATCCTCTTTGATCATTTACAA No data
Right 913440248 1:118889412-118889434 ATCACAGAAAAGCTAGGGCAGGG No data
913440242_913440247 22 Left 913440242 1:118889366-118889388 CCATCCTCTTTGATCATTTACAA No data
Right 913440247 1:118889411-118889433 CATCACAGAAAAGCTAGGGCAGG 0: 1
1: 0
2: 1
3: 20
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913440242 Original CRISPR TTGTAAATGATCAAAGAGGA TGG (reversed) Intronic
No off target data available for this crispr