ID: 913440925

View in Genome Browser
Species Human (GRCh38)
Location 1:118896790-118896812
Sequence TCTTAGTTCTTAAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913440921_913440925 -7 Left 913440921 1:118896774-118896796 CCAGAGTCACTGAAACTCTTAGT 0: 1
1: 0
2: 1
3: 11
4: 166
Right 913440925 1:118896790-118896812 TCTTAGTTCTTAAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913440925 Original CRISPR TCTTAGTTCTTAAGGGAAGA GGG Intronic
No off target data available for this crispr